Strain Name:
C57BL/6J-MtgxR9335Btlr/Mmmh
Stock Number:
069147-MU
Citation ID:
RRID:MMRRC_069147-MU
Other Names:
R9335 (G1)
Major Collection:

Strain Information

Epha7
Name: Eph receptor A7
Synonyms: MDK1, Mdk1, Hek11, Ehk3, Cek11, Ebk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Enah
Name: ENAH actin regulator
Synonyms: Ndpp1, Mena
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13800
Homologene: 134005
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: b2b1625.2Clo, Gp330, Megalin, D230004K18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Setx
Name: senataxin
Synonyms: Als4, A930037J23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Arfgef1
Name: ADP ribosylation factor guanine nucleotide exchange factor 1
Synonyms: D730028O18Rik, D130059B05Rik, BIG1, ARFGEP1, P200
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 211673
Homologene: 4687
Picalm
Name: phosphatidylinositol binding clathrin assembly protein
Synonyms: fit-1, fit1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233489
Homologene: 111783
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Phip
Name: pleckstrin homology domain interacting protein
Synonyms: 4632404O06Rik, 2810004D21Rik, Ndrp, Wdr11
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83946
Homologene: 41209
Sdhb
Name: succinate dehydrogenase complex, subunit B, iron sulfur (Ip)
Synonyms: 0710008N11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67680
Homologene: 2255
Fam114a2
Name: family with sequence similarity 114, member A2
Synonyms: 9030624B09Rik, 1810073G14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67726
HGNC: HGNC:1333
Homologene: 10270
Sertm1
Name: serine rich and transmembrane domain containing 1
Synonyms: 6030405A18Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329641
Homologene: 45594
Brms1l
Name: breast cancer metastasis-suppressor 1-like
Synonyms: BRMS1, 0710008O11Rik, D12Ertd407e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 52592
VEGA: 12
Homologene: 9123
Ppp4r3a
Name: protein phosphatase 4 regulatory subunit 3A
Synonyms: 1110034C04Rik, Smek1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68734
VEGA: 12
Homologene: 69510
Mcf2l
Name: mcf.2 transforming sequence-like
Synonyms: Dbs, C130040G20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17207
Homologene: 11804
Rfwd3
Name: ring finger and WD repeat domain 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234736
Homologene: 41230
Egfr
Name: epidermal growth factor receptor
Synonyms: 9030024J15Rik, Wa5, Erbb, Errb1, avian erythroblastic leukemia viral (v-erb-b) oncogene homolog
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13649
HGNC: HGNC:3236
Homologene: 74545
Sv2a
Name: synaptic vesicle glycoprotein 2a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 64051
Homologene: 32237
Glmp
Name: glycosylated lysosomal membrane protein
Synonyms: NCU-G1, 0610031J06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56700
Homologene: 10562
Ppa1
Name: pyrophosphatase (inorganic) 1
Synonyms: 2010317E03Rik, Pyp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67895
HGNC: HGNC:9226
Homologene: 5356
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, b2b414Clo, Dnchc2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, m152Asp, m407Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Atl2
Name: atlastin GTPase 2
Synonyms: Aip-2, 2010110I21Rik, Arl6ip2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56298
VEGA: 17
Homologene: 56949
Usf3
Name: upstream transcription factor family member 3
Synonyms: 5530400K22Rik, Gm608, LOC207806, LOC385650
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207806
Homologene: 19504
C1rl
Name: complement component 1, r subcomponent-like
Synonyms: C1rl1, C1r-LP
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232371
Homologene: 9559
Prlr
Name: prolactin receptor
Synonyms: Prlr-rs1, Pr-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19116
HGNC: HGNC:9446
Homologene: 733
Sp9
Name: trans-acting transcription factor 9
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381373
Homologene: 66935
Unc13b
Name: unc-13 homolog B
Synonyms: Munc13-2, Unc13h2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Magi2
Name: membrane associated guanylate kinase, WW and PDZ domain containing 2
Synonyms: Acvrinp1, Magi-2, S-SCAM
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50791
Homologene: 8189
Afm
Name: afamin
Synonyms: alpha albumin, Alf
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 280662
HGNC: HGNC:316
Homologene: 881
Elmod1
Name: ELMO/CED-12 domain containing 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270162
VEGA: 9
Homologene: 10280
Ermap
Name: erythroblast membrane-associated protein
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 27028
Homologene: 22782
D430041D05Rik
Name: RIKEN cDNA D430041D05 gene
Synonyms: G2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241589
Homologene: 115928
Ect2l
Name: epithelial cell transforming sequence 2 oncogene-like
Synonyms: C330021H03Rik, Gm10331
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100045792
Homologene: 46005
Or2aj4
Name: olfactory receptor family 2 subfamily AJ member 4
Synonyms: Olfr169, MOR273-3P, GA_x54KRFPKG5P-16014972-16014031
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258158
Homologene: 128058
Tbc1d9
Name: TBC1 domain family, member 9
Synonyms: C76116, 4933431N12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71310
Homologene: 57079
Cd101
Name: CD101 antigen
Synonyms: Igsf2, LOC381460
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 630146
HGNC: HGNC:5949
Homologene: 3142
Tpk1
Name: thiamine pyrophosphokinase
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 29807
Homologene: 6960
Dnai2
Name: dynein axonemal intermediate chain 2
Synonyms: b2b3405Clo, C030015H18Rik, Dnaic2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432611
Homologene: 11311
Prrt3
Name: proline-rich transmembrane protein 3
Synonyms: B230206N24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 210673
Homologene: 52099
Dennd4b
Name: DENN domain containing 4B
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229541
Homologene: 28281
Ptk6
Name: PTK6 protein tyrosine kinase 6
Synonyms: Sik, Tksk
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20459
HGNC: HGNC:9617
Homologene: 68494
Apol7c
Name: apolipoprotein L 7c
Synonyms: 2210421G13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 108956
VEGA: 15
HGNC: HGNC:619
Homologene: 40940
Epcip
Name: exosomal polycystin 1 interacting protein
Synonyms: 4932438H23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74387
HGNC: HGNC:1305
Homologene: 49594
Zfp518a
Name: zinc finger protein 518A
Synonyms: 6330417C12Rik, 2810401C22Rik, Zfp518
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72672
VEGA: 19
Homologene: 19378
Cacna2d4
Name: calcium channel, voltage-dependent, alpha 2/delta subunit 4
Synonyms: 5730412N02Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 319734
Homologene: 26544
Prodh
Name: proline dehydrogenase
Synonyms: Pro1, Ym24d07, Pro-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19125
HGNC: HGNC:9453
Homologene: 40764
Slc26a4
Name: solute carrier family 26, member 4
Synonyms: pendrin, Pds
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 23985
VEGA: 12
HGNC: HGNC:8818
Homologene: 20132
Dcbld2
Name: discoidin, CUB and LCCL domain containing 2
Synonyms: Esdn, CLCP1, 1700055P21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 73379
Homologene: 12499
Aldh1l2
Name: aldehyde dehydrogenase 1 family, member L2
Synonyms: D330038I09Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216188
Homologene: 51942
Laptm5
Name: lysosomal-associated protein transmembrane 5
Synonyms: E3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16792
Homologene: 4922
Tmem67
Name: transmembrane protein 67
Synonyms: b2b1291.1Clo, 5330408M12Rik, b2b1163.1Clo
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329795
Homologene: 71886
Itga2b
Name: integrin alpha 2b
Synonyms: platelet glycoprotein IIb, CD41, GP IIb, alphaIIb, GpIIb
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16399
HGNC: HGNC:6138
Homologene: 37304
Vmn2r60
Name: vomeronasal 2, receptor 60
Synonyms: EG637898, Casr-rs3, Gprc2a-rs3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637898
Homologene: 129683
Or6c8b
Name: olfactory receptor family 6 subfamily C member 8B
Synonyms: MOR115-4, GA_x6K02T2PULF-10732607-10731678, Olfr765
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 544748
Homologene: 105186
Serpinb3a
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3A
Synonyms: Sqn5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20248
Homologene: 76659
Sfxn4
Name: sideroflexin 4
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 94281
Homologene: 14228
Zfp974
Name: zinc finger protein 974
Synonyms: 1700049G17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73430
Rec114
Name: REC114 meiotic recombination protein
Synonyms: 4930527A11Rik, 2410076I21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73673
Homologene: 83546
Serinc2
Name: serine incorporator 2
Synonyms: Tde2l, TDE2, FKSG84, 2310004K20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230779
Homologene: 27797
Gm4553
Name: predicted gene 4553
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043617
Lmtk3
Name: lemur tyrosine kinase 3
Synonyms: AATYK3, Aatyk3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381983
Homologene: 79449
Cd177
Name: CD177 antigen
Synonyms: Pdp3, 1190003K14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68891
Homologene: 49628
Prx
Name: periaxin
Synonyms: L-Periaxin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19153
Homologene: 76542
Grid1
Name: glutamate receptor, ionotropic, delta 1
Synonyms: GluRdelta1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14803
HGNC: HGNC:4575
Homologene: 69017
Hao2
Name: hydroxyacid oxidase 2
Synonyms: Hao3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56185
HGNC: HGNC:4810
Homologene: 97412
Vmn1r36
Name: vomeronasal 1 receptor 36
Synonyms: V1rc11
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171184
Homologene: 110800
Or51ag1
Name: olfactory receptor family 51 subfamily AG member 1
Synonyms: Olfr610, MOR9-2, GA_x6K02T2PBJ9-6221839-6220892
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259085
Homologene: 17495
Hemgn
Name: hemogen
Synonyms: EDAG, 4921524M03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 93966
Homologene: 14223
Eid1
Name: EP300 interacting inhibitor of differentiation 1
Synonyms: EID-1, Cri1, ORF12, 2610002K20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 58521
HGNC: HGNC:1191
Homologene: 49376
Gdap1
Name: ganglioside-induced differentiation-associated-protein 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14545
Homologene: 40713
Or1a1b
Name: olfactory receptor family 1 subfamily A member 1B
Synonyms: Olfr43, MOR125-1, GA_x6K02T2P1NL-4359899-4358958
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258706
Homologene: 8219
Vmn2r42
Name: vomeronasal 2, receptor 42
Synonyms: V2r4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22310
Homologene: 113703
Mettl4
Name: methyltransferase 4, N6-adenosine
Synonyms: HsT661, 2410198H06Rik, A730091E08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76781
VEGA: 17
Homologene: 35305
Ssbp1
Name: single-stranded DNA binding protein 1
Synonyms: 2810480P10Rik, G630031O20Rik, mtDBP
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381760
Homologene: 74462
Tnni2
Name: troponin I, skeletal, fast 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21953
Homologene: 37752
Naaladl2
Name: N-acetylated alpha-linked acidic dipeptidase-like 2
Synonyms: EG635702, 2810043G22Rik, LOC381500
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 635702
Homologene: 45786
Gm10203
Name: predicted gene 10203
Type: Gene
Species: Mouse
Chromosome: 6
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 10,158,011 bp (GRCm38)
  • A to G, chromosome 1 at 17,161,165 bp (GRCm38)
  • A to C, chromosome 1 at 107,047,156 bp (GRCm38)
  • G to A, chromosome 1 at 181,921,885 bp (GRCm38)
  • A to G, chromosome 2 at 29,145,951 bp (GRCm38)
  • A to G, chromosome 2 at 69,428,639 bp (GRCm38)
  • T to C, chromosome 2 at 73,274,277 bp (GRCm38)
  • A to T, chromosome 2 at 104,248,329 bp (GRCm38)
  • T to G, chromosome 2 at 125,673,658 bp (GRCm38)
  • T to G, chromosome 2 at 181,202,353 bp (GRCm38)
  • T to G, chromosome 3 at 24,413,368 bp (GRCm38)
  • T to C, chromosome 3 at 54,899,508 bp (GRCm38)
  • T to A, chromosome 3 at 88,328,256 bp (GRCm38)
  • T to C, chromosome 3 at 90,268,304 bp (GRCm38)
  • G to A, chromosome 3 at 96,185,272 bp (GRCm38)
  • C to A, chromosome 3 at 98,883,694 bp (GRCm38)
  • A to T, chromosome 3 at 101,008,115 bp (GRCm38)
  • G to A, chromosome 4 at 12,040,640 bp (GRCm38)
  • A to G, chromosome 4 at 28,966,529 bp (GRCm38)
  • T to A, chromosome 4 at 43,216,123 bp (GRCm38)
  • A to T, chromosome 4 at 43,255,551 bp (GRCm38)
  • A to T, chromosome 4 at 46,394,647 bp (GRCm38)
  • T to A, chromosome 4 at 119,178,348 bp (GRCm38)
  • T to G, chromosome 4 at 130,264,427 bp (GRCm38)
  • T to G, chromosome 4 at 130,929,528 bp (GRCm38)
  • C to T, chromosome 4 at 140,972,939 bp (GRCm38)
  • A to G, chromosome 5 at 20,661,265 bp (GRCm38)
  • A to T, chromosome 5 at 90,550,227 bp (GRCm38)
  • T to C, chromosome 6 at 40,478,021 bp (GRCm38)
  • T to C, chromosome 6 at 43,469,150 bp (GRCm38)
  • A to T, chromosome 6 at 66,716,446 bp (GRCm38)
  • T to C, chromosome 6 at 113,498,097 bp (GRCm38)
  • T to A, chromosome 6 at 119,302,053 bp (GRCm38)
  • A to T, chromosome 6 at 124,505,382 bp (GRCm38)
  • C to T, chromosome 6 at 149,130,317 bp (GRCm38)
  • A to C, chromosome 7 at 8,194,759 bp (GRCm38)
  • A to G, chromosome 7 at 24,744,286 bp (GRCm38)
  • G to T, chromosome 7 at 27,518,071 bp (GRCm38)
  • A to T, chromosome 7 at 27,912,051 bp (GRCm38)
  • A to T, chromosome 7 at 42,194,908 bp (GRCm38)
  • A to T, chromosome 7 at 45,792,741 bp (GRCm38)
  • A to G, chromosome 7 at 90,176,283 bp (GRCm38)
  • C to T, chromosome 7 at 103,506,520 bp (GRCm38)
  • ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC to ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC, chromosome 7 at 142,165,420 bp (GRCm38)
  • T to C, chromosome 7 at 142,444,266 bp (GRCm38)
  • C to A, chromosome 8 at 13,000,812 bp (GRCm38)
  • G to T, chromosome 8 at 83,210,531 bp (GRCm38)
  • T to G, chromosome 8 at 111,279,935 bp (GRCm38)
  • A to C, chromosome 9 at 7,112,149 bp (GRCm38)
  • A to T, chromosome 9 at 53,935,832 bp (GRCm38)
  • T to A, chromosome 9 at 58,657,758 bp (GRCm38)
  • T to A, chromosome 9 at 82,932,926 bp (GRCm38)
  • T to A, chromosome 10 at 18,201,284 bp (GRCm38)
  • T to G, chromosome 10 at 61,648,783 bp (GRCm38)
  • C to T, chromosome 10 at 83,506,646 bp (GRCm38)
  • C to T, chromosome 10 at 129,046,745 bp (GRCm38)
  • C to A, chromosome 11 at 16,870,991 bp (GRCm38)
  • G to T, chromosome 11 at 57,506,922 bp (GRCm38)
  • T to A, chromosome 11 at 74,207,006 bp (GRCm38)
  • T to C, chromosome 11 at 102,455,652 bp (GRCm38)
  • A to G, chromosome 11 at 114,734,663 bp (GRCm38)
  • T to C, chromosome 12 at 31,525,554 bp (GRCm38)
  • C to A, chromosome 12 at 55,841,646 bp (GRCm38)
  • T to C, chromosome 12 at 101,040,754 bp (GRCm38)
  • C to T, chromosome 12 at 114,366,692 bp (GRCm38)
  • G to A, chromosome 14 at 35,321,707 bp (GRCm38)
  • A to T, chromosome 15 at 10,325,271 bp (GRCm38)
  • G to T, chromosome 15 at 77,525,689 bp (GRCm38)
  • C to A, chromosome 16 at 18,076,296 bp (GRCm38)
  • G to A, chromosome 16 at 19,566,763 bp (GRCm38)
  • G to T, chromosome 16 at 44,221,573 bp (GRCm38)
  • A to T, chromosome 16 at 58,451,778 bp (GRCm38)
  • G to T, chromosome 16 at 91,055,942 bp (GRCm38)
  • A to G, chromosome 17 at 79,852,778 bp (GRCm38)
  • T to A, chromosome 17 at 94,735,508 bp (GRCm38)
  • A to G, chromosome 18 at 49,859,120 bp (GRCm38)
  • G to A, chromosome 19 at 40,912,781 bp (GRCm38)
  • T to A, chromosome 19 at 60,851,056 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9335 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069147-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.