Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9335Btlr/Mmmh
Stock Number:
069147-MU
Citation ID:
RRID:MMRRC_069147-MU
Other Names:
R9335 (G1)
Major Collection:

Strain Information

Epha7
Name: Eph receptor A7
Synonyms: MDK1, Ebk, Cek11, Ehk3, Hek11, Mdk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Setx
Name: senataxin
Synonyms: A930037J23Rik, Als4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Arfgef1
Name: ARF guanine nucleotide exchange factor 1
Synonyms: D730028O18Rik, ARFGEP1, P200, BIG1, D130059B05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 211673
Homologene: 4687
Picalm
Name: phosphatidylinositol binding clathrin assembly protein
Synonyms: fit-1, fit1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233489
Homologene: 111783
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 10,158,011 bp (GRCm38)
  • A to G, chromosome 1 at 17,161,165 bp (GRCm38)
  • A to C, chromosome 1 at 107,047,156 bp (GRCm38)
  • G to A, chromosome 1 at 181,921,885 bp (GRCm38)
  • A to G, chromosome 2 at 29,145,951 bp (GRCm38)
  • A to G, chromosome 2 at 69,428,639 bp (GRCm38)
  • T to C, chromosome 2 at 73,274,277 bp (GRCm38)
  • A to T, chromosome 2 at 104,248,329 bp (GRCm38)
  • T to G, chromosome 2 at 125,673,658 bp (GRCm38)
  • T to G, chromosome 2 at 181,202,353 bp (GRCm38)
  • T to G, chromosome 3 at 24,413,368 bp (GRCm38)
  • T to C, chromosome 3 at 54,899,508 bp (GRCm38)
  • T to A, chromosome 3 at 88,328,256 bp (GRCm38)
  • T to C, chromosome 3 at 90,268,304 bp (GRCm38)
  • G to A, chromosome 3 at 96,185,272 bp (GRCm38)
  • C to A, chromosome 3 at 98,883,694 bp (GRCm38)
  • A to T, chromosome 3 at 101,008,115 bp (GRCm38)
  • G to A, chromosome 4 at 12,040,640 bp (GRCm38)
  • A to G, chromosome 4 at 28,966,529 bp (GRCm38)
  • T to A, chromosome 4 at 43,216,123 bp (GRCm38)
  • A to T, chromosome 4 at 43,255,551 bp (GRCm38)
  • A to T, chromosome 4 at 46,394,647 bp (GRCm38)
  • T to A, chromosome 4 at 119,178,348 bp (GRCm38)
  • T to G, chromosome 4 at 130,264,427 bp (GRCm38)
  • T to G, chromosome 4 at 130,929,528 bp (GRCm38)
  • C to T, chromosome 4 at 140,972,939 bp (GRCm38)
  • A to G, chromosome 5 at 20,661,265 bp (GRCm38)
  • A to T, chromosome 5 at 90,550,227 bp (GRCm38)
  • T to C, chromosome 6 at 40,478,021 bp (GRCm38)
  • T to C, chromosome 6 at 43,469,150 bp (GRCm38)
  • A to T, chromosome 6 at 66,716,446 bp (GRCm38)
  • T to C, chromosome 6 at 113,498,097 bp (GRCm38)
  • T to A, chromosome 6 at 119,302,053 bp (GRCm38)
  • A to T, chromosome 6 at 124,505,382 bp (GRCm38)
  • C to T, chromosome 6 at 149,130,317 bp (GRCm38)
  • A to C, chromosome 7 at 8,194,759 bp (GRCm38)
  • A to G, chromosome 7 at 24,744,286 bp (GRCm38)
  • G to T, chromosome 7 at 27,518,071 bp (GRCm38)
  • A to T, chromosome 7 at 27,912,051 bp (GRCm38)
  • A to T, chromosome 7 at 42,194,908 bp (GRCm38)
  • A to T, chromosome 7 at 45,792,741 bp (GRCm38)
  • A to G, chromosome 7 at 90,176,283 bp (GRCm38)
  • C to T, chromosome 7 at 103,506,520 bp (GRCm38)
  • ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC to ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC, chromosome 7 at 142,165,420 bp (GRCm38)
  • T to C, chromosome 7 at 142,444,266 bp (GRCm38)
  • C to A, chromosome 8 at 13,000,812 bp (GRCm38)
  • G to T, chromosome 8 at 83,210,531 bp (GRCm38)
  • T to G, chromosome 8 at 111,279,935 bp (GRCm38)
  • A to C, chromosome 9 at 7,112,149 bp (GRCm38)
  • A to T, chromosome 9 at 53,935,832 bp (GRCm38)
  • T to A, chromosome 9 at 58,657,758 bp (GRCm38)
  • T to A, chromosome 9 at 82,932,926 bp (GRCm38)
  • T to A, chromosome 10 at 18,201,284 bp (GRCm38)
  • T to G, chromosome 10 at 61,648,783 bp (GRCm38)
  • C to T, chromosome 10 at 83,506,646 bp (GRCm38)
  • C to T, chromosome 10 at 129,046,745 bp (GRCm38)
  • C to A, chromosome 11 at 16,870,991 bp (GRCm38)
  • G to T, chromosome 11 at 57,506,922 bp (GRCm38)
  • T to A, chromosome 11 at 74,207,006 bp (GRCm38)
  • T to C, chromosome 11 at 102,455,652 bp (GRCm38)
  • A to G, chromosome 11 at 114,734,663 bp (GRCm38)
  • T to C, chromosome 12 at 31,525,554 bp (GRCm38)
  • C to A, chromosome 12 at 55,841,646 bp (GRCm38)
  • T to C, chromosome 12 at 101,040,754 bp (GRCm38)
  • C to T, chromosome 12 at 114,366,692 bp (GRCm38)
  • G to A, chromosome 14 at 35,321,707 bp (GRCm38)
  • A to T, chromosome 15 at 10,325,271 bp (GRCm38)
  • G to T, chromosome 15 at 77,525,689 bp (GRCm38)
  • C to A, chromosome 16 at 18,076,296 bp (GRCm38)
  • G to A, chromosome 16 at 19,566,763 bp (GRCm38)
  • G to T, chromosome 16 at 44,221,573 bp (GRCm38)
  • A to T, chromosome 16 at 58,451,778 bp (GRCm38)
  • G to T, chromosome 16 at 91,055,942 bp (GRCm38)
  • A to G, chromosome 17 at 79,852,778 bp (GRCm38)
  • T to A, chromosome 17 at 94,735,508 bp (GRCm38)
  • A to G, chromosome 18 at 49,859,120 bp (GRCm38)
  • G to A, chromosome 19 at 40,912,781 bp (GRCm38)
  • T to A, chromosome 19 at 60,851,056 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9335 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069147-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.