Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9383Btlr/Mmmh
Stock Number:
069190-MU
Citation ID:
RRID:MMRRC_069190-MU
Other Names:
R9383 (G1)
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: polycystin-1, PC1, PC-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Ccn2
Name: cellular communication network factor 2
Synonyms: Hcs24, hypertrophic chondrocyte-specific gene product 24, Fisp12, Ccn2, Ctgf
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14219
HGNC: HGNC:2500
Homologene: 1431
Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Slc4a7
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 7
Synonyms: E430014N10Rik, NBC3, NBCn1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218756
VEGA: 14
Homologene: 2680
Prtg
Name: protogenin
Synonyms: A230098A12Rik, Igdcc5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235472
Homologene: 54453
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to A, chromosome 1 at 60,525,670 bp (GRCm38)
  • C to T, chromosome 1 at 171,385,683 bp (GRCm38)
  • T to C, chromosome 1 at 172,279,767 bp (GRCm38)
  • T to A, chromosome 2 at 15,695,201 bp (GRCm38)
  • T to A, chromosome 2 at 29,901,237 bp (GRCm38)
  • G to A, chromosome 2 at 84,860,162 bp (GRCm38)
  • T to C, chromosome 2 at 86,508,510 bp (GRCm38)
  • G to A, chromosome 2 at 150,472,583 bp (GRCm38)
  • T to C, chromosome 3 at 20,228,881 bp (GRCm38)
  • T to C, chromosome 3 at 103,777,567 bp (GRCm38)
  • T to C, chromosome 4 at 108,189,729 bp (GRCm38)
  • A to G, chromosome 4 at 116,034,276 bp (GRCm38)
  • C to T, chromosome 4 at 126,043,446 bp (GRCm38)
  • A to T, chromosome 4 at 141,632,301 bp (GRCm38)
  • T to C, chromosome 4 at 152,283,059 bp (GRCm38)
  • T to C, chromosome 4 at 152,544,461 bp (GRCm38)
  • T to C, chromosome 5 at 110,291,026 bp (GRCm38)
  • T to C, chromosome 5 at 110,685,485 bp (GRCm38)
  • C to A, chromosome 5 at 114,658,413 bp (GRCm38)
  • A to G, chromosome 6 at 29,378,001 bp (GRCm38)
  • A to G, chromosome 6 at 49,051,984 bp (GRCm38)
  • A to T, chromosome 6 at 89,869,570 bp (GRCm38)
  • A to G, chromosome 6 at 90,270,027 bp (GRCm38)
  • T to A, chromosome 6 at 139,882,016 bp (GRCm38)
  • T to A, chromosome 7 at 25,302,910 bp (GRCm38)
  • T to A, chromosome 7 at 73,449,170 bp (GRCm38)
  • A to T, chromosome 7 at 118,976,538 bp (GRCm38)
  • A to T, chromosome 7 at 120,047,596 bp (GRCm38)
  • G to A, chromosome 7 at 127,024,911 bp (GRCm38)
  • A to G, chromosome 8 at 94,934,534 bp (GRCm38)
  • G to A, chromosome 8 at 106,050,318 bp (GRCm38)
  • TATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA to TATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,623,969 bp (GRCm38)
  • G to A, chromosome 9 at 21,472,624 bp (GRCm38)
  • A to G, chromosome 9 at 30,435,900 bp (GRCm38)
  • T to G, chromosome 9 at 64,638,450 bp (GRCm38)
  • T to A, chromosome 9 at 67,370,761 bp (GRCm38)
  • G to T, chromosome 9 at 72,849,861 bp (GRCm38)
  • T to C, chromosome 9 at 105,925,911 bp (GRCm38)
  • T to G, chromosome 10 at 24,595,985 bp (GRCm38)
  • A to G, chromosome 10 at 68,003,264 bp (GRCm38)
  • T to A, chromosome 11 at 60,459,461 bp (GRCm38)
  • A to G, chromosome 11 at 61,336,923 bp (GRCm38)
  • G to A, chromosome 11 at 99,011,058 bp (GRCm38)
  • A to G, chromosome 12 at 57,306,034 bp (GRCm38)
  • T to C, chromosome 12 at 104,103,872 bp (GRCm38)
  • A to C, chromosome 13 at 23,034,925 bp (GRCm38)
  • C to A, chromosome 14 at 14,766,803 bp (GRCm38)
  • T to C, chromosome 14 at 63,036,014 bp (GRCm38)
  • T to C, chromosome 15 at 83,872,419 bp (GRCm38)
  • A to T, chromosome 15 at 95,385,076 bp (GRCm38)
  • A to G, chromosome 16 at 4,635,024 bp (GRCm38)
  • C to T, chromosome 16 at 89,858,673 bp (GRCm38)
  • C to T, chromosome 17 at 24,575,926 bp (GRCm38)
  • T to A, chromosome 17 at 30,135,505 bp (GRCm38)
  • T to C, chromosome 17 at 36,032,335 bp (GRCm38)
  • T to C, chromosome 17 at 55,939,355 bp (GRCm38)
  • A to T, chromosome 18 at 44,442,918 bp (GRCm38)
  • C to T, chromosome 19 at 10,669,533 bp (GRCm38)
  • A to G, chromosome 19 at 28,911,725 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9383 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069190-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.