Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9383Btlr/Mmmh
Stock Number:
069190-MU
Citation ID:
RRID:MMRRC_069190-MU
Other Names:
R9383 (G1)
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: polycystin-1, PC1, PC-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Ccn2
Name: cellular communication network factor 2
Synonyms: Hcs24, hypertrophic chondrocyte-specific gene product 24, Fisp12, Ccn2, Ctgf
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14219
HGNC: HGNC:2500
Homologene: 1431
Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Slc4a7
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 7
Synonyms: E430014N10Rik, NBC3, NBCn1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218756
VEGA: 14
Homologene: 2680
Prtg
Name: protogenin
Synonyms: A230098A12Rik, Igdcc5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235472
Homologene: 54453
Coro7
Name: coronin 7
Synonyms: 0610011B16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78885
Homologene: 11573
Top2a
Name: topoisomerase (DNA) II alpha
Synonyms: DNA Topoisomerase II alpha, Top-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21973
Homologene: 830
Tiam1
Name: T cell lymphoma invasion and metastasis 1
Synonyms: D16Ium10, D16Ium10e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21844
Homologene: 2443
Drg2
Name: developmentally regulated GTP binding protein 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13495
HGNC: HGNC:3030
Homologene: 1061
Chd2
Name: chromodomain helicase DNA binding protein 2
Synonyms: 2810040A01Rik, 2810013C04Rik, 5630401D06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244059
HGNC: HGNC:1917
Homologene: 37462
Pole
Name: polymerase (DNA directed), epsilon
Synonyms: pol-epsilon
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18973
HGNC: HGNC:9177
Homologene: 4539
Zfand3
Name: zinc finger, AN1-type domain 3
Synonyms: TEG-27, Tex27
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21769
VEGA: 17
Homologene: 11077
Trpv4
Name: transient receptor potential cation channel, subfamily V, member 4
Synonyms: VR-OAC, Trp12, 0610033B08Rik, OTRPC4, VROAC, VRL-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 63873
Homologene: 11003
Adgrg5
Name: adhesion G protein-coupled receptor G5
Synonyms: LOC382045, PGR27, Gpr114
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382045
Homologene: 17828
Plekhm2
Name: pleckstrin homology domain containing, family M (with RUN domain) member 2
Synonyms: 2310034J19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69582
Homologene: 19575
Raph1
Name: Ras association (RalGDS/AF-6) and pleckstrin homology domains 1
Synonyms: C730009O10Rik, 9430025M21Rik, lamellipodin, Lpd
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77300
Homologene: 71030
Zfp345
Name: zinc finger protein 345
Synonyms: OTTMUSG00000015743
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545471
Homologene: 134546
H2-T23
Name: histocompatibility 2, T region locus 23
Synonyms: H-2T23, T18c(37), T18c, 37c, 37b, T23d, T23b, Qed-1, Qa1, Qa-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15040
Homologene: 134018
Gprc5b
Name: G protein-coupled receptor, family C, group 5, member B
Synonyms: hypothetical protein, clone 2-63
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 64297
Homologene: 9435
Efcab6
Name: EF-hand calcium binding domain 6
Synonyms: 4932408N08Rik, 4931407K02Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 77627
Homologene: 11259
Mipol1
Name: mirror-image polydactyly 1
Synonyms: 1700081O04Rik, 6030439O22Rik, D12Ertd19e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73490
Homologene: 16340
Pik3c2g
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18705
HGNC: HGNC:8973
Homologene: 3362
Slc1a1
Name: solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
Synonyms: MEAAC1, EAAC1, EAAT3, D130048G10Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20510
Homologene: 20881
Mcc
Name: mutated in colorectal cancers
Synonyms: D18Ertd451e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 328949
HGNC: HGNC:6935
Homologene: 20539
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Hipk1
Name: homeodomain interacting protein kinase 1
Synonyms: Myak, 1110062K04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 15257
Homologene: 56483
Csf3r
Name: colony stimulating factor 3 receptor
Synonyms: G-CSFR, Csfgr, Cd114
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12986
HGNC: HGNC:2439
Homologene: 601
Slc47a2
Name: solute carrier family 47, member 2
Synonyms: 4933429E10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380701
Homologene: 134426
Maz
Name: MYC-associated zinc finger protein (purine-binding transcription factor)
Synonyms: Pur-1, PUR1, SAF-2, SAF-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17188
HGNC: HGNC:6914
Homologene: 106451
Col6a5
Name: collagen, type VI, alpha 5
Synonyms: Col6a5, Gm7455
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 665033
Homologene: 122792
Cpa3
Name: carboxypeptidase A3, mast cell
Synonyms: MC-CPA, mMC-CPA, mast cell carboxypeptidase A
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12873
HGNC: HGNC:2298
Homologene: 122138
Nsun4
Name: NOL1/NOP2/Sun domain family, member 4
Synonyms: 2310010O12Rik, 2810405F18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72181
Homologene: 12455
Zyg11a
Name: zyg-11 family member A, cell cycle regulator
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230590
Homologene: 66294
Nell2
Name: NEL-like 2
Synonyms: mel91, A330108N19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54003
VEGA: 15
HGNC: HGNC:7751
Homologene: 4488
Vmn1r214
Name: vomeronasal 1 receptor 214
Synonyms: V1rh5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171248
Homologene: 110880
Atp1a2
Name: ATPase, Na+/K+ transporting, alpha 2 polypeptide
Synonyms: Atpa-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98660
HGNC: HGNC:800
Homologene: 47947
Snx19
Name: sorting nexin 19
Synonyms: 3526401K03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102607
VEGA: 9
Homologene: 8846
Serpina5
Name: serine (or cysteine) peptidase inhibitor, clade A, member 5
Synonyms: Pci, antitrypsin, alpha-1 antiproteinase, PAI-3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268591
HGNC: HGNC:8723
Homologene: 20159
Pga5
Name: pepsinogen 5, group I
Synonyms: 1110035E17Rik, pepsinogen A5, Pepf
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 58803
VEGA: 19
Homologene: 105932
Gpnmb
Name: glycoprotein (transmembrane) nmb
Synonyms: Dchil, Osteoactivin, DC-HIL
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 93695
HGNC: HGNC:4462
Homologene: 1880
Megf11
Name: multiple EGF-like-domains 11
Synonyms: 2410080H04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214058
Homologene: 13031
Nphp4
Name: nephronophthisis 4 (juvenile) homolog (human)
Synonyms: 4930564O18Rik, nmf192
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 260305
Homologene: 9024
Or8k30
Name: olfactory receptor family 8 subfamily K member 30
Synonyms: GA_x6K02T2Q125-47993761-47994702, MOR189-2, Olfr1076
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258401
Homologene: 17233
Zfp119b
Name: zinc finger protein 119b
Synonyms: BC031441
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240120
Dus2
Name: dihydrouridine synthase 2
Synonyms: 2310016K04Rik, Dus2l
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66369
Homologene: 6838
Vmn1r43
Name: vomeronasal 1 receptor 43
Synonyms: V1ra5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113847
Homologene: 130651
Opn1sw
Name: opsin 1 (cone pigments), short-wave-sensitive (color blindness, tritan)
Synonyms: Blue/UV Opsin, Blue Opsin, SWS opsin, Short Wavelength Sensitive opsin, S Opsin, Blue Cone Opsin, Bcp, UV cone pigment
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12057
HGNC: HGNC:1012
Homologene: 1291
Defb30
Name: defensin beta 30
Synonyms: 4930449O14Rik, 2410125J01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 73670
Homologene: 86862
Vmn1r54
Name: vomeronasal 1 receptor 54
Synonyms: VN7, V1ra9
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113851
Gpr153
Name: G protein-coupled receptor 153
Synonyms: 1110065N12Rik, PGR1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100129
Homologene: 18662
Rtkn2
Name: rhotekin 2
Synonyms: B130039D23Rik, RTKN2, Mbf, Plekhk1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 170799
Homologene: 17065
Slc43a1
Name: solute carrier family 43, member 1
Synonyms: PB39, 2610016F07Rik, Pov1, Lat3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72401
HGNC: HGNC:9225
Homologene: 2688
Nectin4
Name: nectin cell adhesion molecule 4
Synonyms: nectin 4, Prr4, 1200017F15Rik, Pvrl4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71740
Homologene: 32744
Prr19
Name: proline rich 19
Synonyms: EG623131
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 623131
Homologene: 85197
Malrd1
Name: MAM and LDL receptor class A domain containing 1
Synonyms: Diet1, Gm13318, Gm13364
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 102635496
Homologene: 136214
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to A, chromosome 1 at 60,525,670 bp (GRCm38)
  • C to T, chromosome 1 at 171,385,683 bp (GRCm38)
  • T to C, chromosome 1 at 172,279,767 bp (GRCm38)
  • T to A, chromosome 2 at 15,695,201 bp (GRCm38)
  • T to A, chromosome 2 at 29,901,237 bp (GRCm38)
  • G to A, chromosome 2 at 84,860,162 bp (GRCm38)
  • T to C, chromosome 2 at 86,508,510 bp (GRCm38)
  • G to A, chromosome 2 at 150,472,583 bp (GRCm38)
  • T to C, chromosome 3 at 20,228,881 bp (GRCm38)
  • T to C, chromosome 3 at 103,777,567 bp (GRCm38)
  • T to C, chromosome 4 at 108,189,729 bp (GRCm38)
  • A to G, chromosome 4 at 116,034,276 bp (GRCm38)
  • C to T, chromosome 4 at 126,043,446 bp (GRCm38)
  • A to T, chromosome 4 at 141,632,301 bp (GRCm38)
  • T to C, chromosome 4 at 152,283,059 bp (GRCm38)
  • T to C, chromosome 4 at 152,544,461 bp (GRCm38)
  • T to C, chromosome 5 at 110,291,026 bp (GRCm38)
  • T to C, chromosome 5 at 110,685,485 bp (GRCm38)
  • C to A, chromosome 5 at 114,658,413 bp (GRCm38)
  • A to G, chromosome 6 at 29,378,001 bp (GRCm38)
  • A to G, chromosome 6 at 49,051,984 bp (GRCm38)
  • A to T, chromosome 6 at 89,869,570 bp (GRCm38)
  • A to G, chromosome 6 at 90,270,027 bp (GRCm38)
  • T to A, chromosome 6 at 139,882,016 bp (GRCm38)
  • T to A, chromosome 7 at 25,302,910 bp (GRCm38)
  • T to A, chromosome 7 at 73,449,170 bp (GRCm38)
  • A to T, chromosome 7 at 118,976,538 bp (GRCm38)
  • A to T, chromosome 7 at 120,047,596 bp (GRCm38)
  • G to A, chromosome 7 at 127,024,911 bp (GRCm38)
  • A to G, chromosome 8 at 94,934,534 bp (GRCm38)
  • G to A, chromosome 8 at 106,050,318 bp (GRCm38)
  • TATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA to TATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,623,969 bp (GRCm38)
  • G to A, chromosome 9 at 21,472,624 bp (GRCm38)
  • A to G, chromosome 9 at 30,435,900 bp (GRCm38)
  • T to G, chromosome 9 at 64,638,450 bp (GRCm38)
  • T to A, chromosome 9 at 67,370,761 bp (GRCm38)
  • G to T, chromosome 9 at 72,849,861 bp (GRCm38)
  • T to C, chromosome 9 at 105,925,911 bp (GRCm38)
  • T to G, chromosome 10 at 24,595,985 bp (GRCm38)
  • A to G, chromosome 10 at 68,003,264 bp (GRCm38)
  • T to A, chromosome 11 at 60,459,461 bp (GRCm38)
  • A to G, chromosome 11 at 61,336,923 bp (GRCm38)
  • G to A, chromosome 11 at 99,011,058 bp (GRCm38)
  • A to G, chromosome 12 at 57,306,034 bp (GRCm38)
  • T to C, chromosome 12 at 104,103,872 bp (GRCm38)
  • A to C, chromosome 13 at 23,034,925 bp (GRCm38)
  • C to A, chromosome 14 at 14,766,803 bp (GRCm38)
  • T to C, chromosome 14 at 63,036,014 bp (GRCm38)
  • T to C, chromosome 15 at 83,872,419 bp (GRCm38)
  • A to T, chromosome 15 at 95,385,076 bp (GRCm38)
  • A to G, chromosome 16 at 4,635,024 bp (GRCm38)
  • C to T, chromosome 16 at 89,858,673 bp (GRCm38)
  • C to T, chromosome 17 at 24,575,926 bp (GRCm38)
  • T to A, chromosome 17 at 30,135,505 bp (GRCm38)
  • T to C, chromosome 17 at 36,032,335 bp (GRCm38)
  • T to C, chromosome 17 at 55,939,355 bp (GRCm38)
  • A to T, chromosome 18 at 44,442,918 bp (GRCm38)
  • C to T, chromosome 19 at 10,669,533 bp (GRCm38)
  • A to G, chromosome 19 at 28,911,725 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9383 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069190-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.