Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9398Btlr/Mmmh
Stock Number:
069202-MU
Citation ID:
RRID:MMRRC_069202-MU
Other Names:
R9398 (G1)
Major Collection:

Strain Information

Notch2
Name: notch 2
Synonyms: Motch B, N2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Dock1
Name: dedicator of cytokinesis 1
Synonyms: D630004B07Rik, 9130006G06Rik, Dock180, b2b3190Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330662
HGNC: HGNC:2987
Homologene: 55575
Por
Name: cytochrome p450 oxidoreductase
Synonyms: NADH cytochrome P450 oxydoreductase, CYPOR, CPR, 4933424M13Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18984
HGNC: HGNC:9208
Homologene: 725
Prex2
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Synonyms: 6230420N16Rik, C030045D06Rik, Depdc2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 109294
Homologene: 23523
Nf1
Name: neurofibromin 1
Synonyms: neurofibromin, Nf-1, Dsk9, Mhdadsk9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Gse1
Name: genetic suppressor element 1, coiled-coil protein
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382034
Homologene: 40964
Mtcl1
Name: microtubule crosslinking factor 1
Synonyms: t8219b25, 1110012J17Rik, Soga2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68617
Homologene: 41017
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to A, chromosome 1 at 11,136,804 bp (GRCm38)
  • A to G, chromosome 1 at 36,318,992 bp (GRCm38)
  • C to T, chromosome 2 at 3,521,038 bp (GRCm38)
  • T to C, chromosome 2 at 85,634,023 bp (GRCm38)
  • A to G, chromosome 2 at 86,806,816 bp (GRCm38)
  • T to A, chromosome 2 at 104,433,217 bp (GRCm38)
  • A to G, chromosome 2 at 181,680,450 bp (GRCm38)
  • A to G, chromosome 3 at 89,447,634 bp (GRCm38)
  • T to C, chromosome 3 at 95,546,947 bp (GRCm38)
  • G to A, chromosome 3 at 98,102,352 bp (GRCm38)
  • T to A, chromosome 4 at 140,246,451 bp (GRCm38)
  • A to T, chromosome 4 at 145,170,386 bp (GRCm38)
  • T to A, chromosome 5 at 87,566,095 bp (GRCm38)
  • A to T, chromosome 5 at 102,913,286 bp (GRCm38)
  • A to T, chromosome 5 at 110,340,272 bp (GRCm38)
  • T to A, chromosome 5 at 135,725,743 bp (GRCm38)
  • G to A, chromosome 6 at 89,869,895 bp (GRCm38)
  • A to G, chromosome 6 at 141,994,785 bp (GRCm38)
  • A to G, chromosome 7 at 13,102,334 bp (GRCm38)
  • T to C, chromosome 7 at 20,049,510 bp (GRCm38)
  • T to A, chromosome 7 at 26,611,631 bp (GRCm38)
  • T to C, chromosome 7 at 46,220,510 bp (GRCm38)
  • A to G, chromosome 7 at 102,887,793 bp (GRCm38)
  • T to A, chromosome 7 at 103,383,280 bp (GRCm38)
  • T to C, chromosome 7 at 104,128,778 bp (GRCm38)
  • A to T, chromosome 7 at 105,156,799 bp (GRCm38)
  • T to C, chromosome 7 at 108,523,828 bp (GRCm38)
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp (GRCm38)
  • GACCAGCTCAGCCACGGG to GACCAGCTCAGCCACGGGTACCAGCTCAGCCACGGG, chromosome 7 at 126,467,574 bp (GRCm38)
  • GCCACGGGGACCAGCTC to GCCACGGGGACCAGCTCATCCACGGGGACCAGCTC, chromosome 7 at 126,467,584 bp (GRCm38)
  • C to T, chromosome 7 at 135,172,499 bp (GRCm38)
  • T to C, chromosome 8 at 35,805,202 bp (GRCm38)
  • A to G, chromosome 8 at 120,576,335 bp (GRCm38)
  • A to G, chromosome 8 at 128,726,124 bp (GRCm38)
  • A to G, chromosome 9 at 21,305,639 bp (GRCm38)
  • G to T, chromosome 9 at 22,448,786 bp (GRCm38)
  • A to G, chromosome 9 at 105,774,626 bp (GRCm38)
  • C to T, chromosome 9 at 108,487,167 bp (GRCm38)
  • G to A, chromosome 10 at 40,257,524 bp (GRCm38)
  • T to G, chromosome 11 at 79,547,192 bp (GRCm38)
  • G to A, chromosome 12 at 38,139,658 bp (GRCm38)
  • T to A, chromosome 12 at 57,737,618 bp (GRCm38)
  • T to G, chromosome 12 at 82,651,841 bp (GRCm38)
  • G to T, chromosome 13 at 54,739,570 bp (GRCm38)
  • G to A, chromosome 13 at 64,903,834 bp (GRCm38)
  • C to T, chromosome 14 at 45,657,660 bp (GRCm38)
  • T to C, chromosome 14 at 50,828,972 bp (GRCm38)
  • A to T, chromosome 14 at 80,011,809 bp (GRCm38)
  • A to G, chromosome 15 at 89,160,919 bp (GRCm38)
  • A to T, chromosome 15 at 101,137,043 bp (GRCm38)
  • A to G, chromosome 16 at 37,061,032 bp (GRCm38)
  • A to G, chromosome 16 at 44,013,018 bp (GRCm38)
  • A to G, chromosome 17 at 66,129,917 bp (GRCm38)
  • A to T, chromosome 17 at 66,448,467 bp (GRCm38)
  • T to C, chromosome 18 at 62,179,205 bp (GRCm38)
  • T to A, chromosome 18 at 65,809,497 bp (GRCm38)
  • T to G, chromosome 19 at 45,024,769 bp (GRCm38)
  • A to G, chromosome 19 at 50,225,213 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9398 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069202-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.