Strain Name:
C57BL/6J-MtgxR9398Btlr/Mmmh
Stock Number:
069202-MU
Citation ID:
RRID:MMRRC_069202-MU
Other Names:
R9398 (G1)
Major Collection:

Strain Information

Notch2
Name: notch 2
Synonyms: Motch B, N2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Dock1
Name: dedicator of cytokinesis 1
Synonyms: Dock180, b2b3190Clo, 9130006G06Rik, D630004B07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330662
HGNC: HGNC:2987
Homologene: 55575
Por
Name: cytochrome p450 oxidoreductase
Synonyms: 4933424M13Rik, CPR, CYPOR, NADH cytochrome P450 oxydoreductase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18984
HGNC: HGNC:9208
Homologene: 725
Prex2
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Synonyms: C030045D06Rik, 6230420N16Rik, Depdc2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 109294
Homologene: 23523
Nf1
Name: neurofibromin 1
Synonyms: Mhdadsk9, neurofibromin, Nf-1, Dsk9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Gse1
Name: genetic suppressor element 1, coiled-coil protein
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382034
Homologene: 40964
Mtcl1
Name: microtubule crosslinking factor 1
Synonyms: t8219b25, Soga2, 1110012J17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68617
Homologene: 41017
Rp9
Name: retinitis pigmentosa 9 (human)
Synonyms: Rp9h, PAP-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 55934
VEGA: 9
Homologene: 10290
Lamb2
Name: laminin, beta 2
Synonyms: Lams, npht, Lamb-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16779
HGNC: HGNC:6487
Homologene: 1723
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Plxnb2
Name: plexin B2
Synonyms: Debt, 1110007H23Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 140570
HGNC: HGNC:9104
Homologene: 66630
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Gramd1c
Name: GRAM domain containing 1C
Synonyms: 4921521N14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207798
Homologene: 129735
Olfm4
Name: olfactomedin 4
Synonyms: LOC380924, GC1, GW112, LOC239192, OlfD, pPD4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 380924
VEGA: 14
Homologene: 4684
Itgb1
Name: integrin beta 1 (fibronectin receptor beta)
Synonyms: 4633401G24Rik, beta1 integrin, CD29, Fnrb, Gm9863
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16412
HGNC: HGNC:6153
Homologene: 22999
Ddx11
Name: DEAD/H box helicase 11
Synonyms: 4732462I11Rik, CHLR1, essa15a, KRG2, CHL1, DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320209
VEGA: 17
Homologene: 68973
Sorcs1
Name: sortilin-related VPS10 domain containing receptor 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 58178
Homologene: 10967
Or5p76
Name: olfactory receptor family 5 subfamily P member 76
Synonyms: GA_x6K02T2PBJ9-10853935-10852991, MOR204-8, Olfr502
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258734
Homologene: 72021
Tcea2
Name: transcription elongation factor A (SII), 2
Synonyms: S-II-T1, Tceat, SII-T1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21400
Homologene: 68304
Polq
Name: polymerase (DNA directed), theta
Synonyms: A430110D14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77782
HGNC: HGNC:9186
Homologene: 32727
Slco1a8
Name: solute carrier organic anion transporter family, member 1a8
Synonyms: Gm6614
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 625716
Homologene: 87075
Ctss
Name: cathepsin S
Synonyms: Cat S
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13040
HGNC: HGNC:2545
Homologene: 20867
Nlrp9b
Name: NLR family, pyrin domain containing 9B
Synonyms: Nalp9b, Nalp-delta
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243874
Homologene: 18530
Ddhd1
Name: DDHD domain containing 1
Synonyms: 9630061G18Rik, 4921528E07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 114874
Homologene: 35221
Col6a6
Name: collagen, type VI, alpha 6
Synonyms: E330026B02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245026
Homologene: 18260
Gm19410
Name: predicted gene, 19410
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100502846
Homologene: 132117
Lzts2
Name: leucine zipper, putative tumor suppressor 2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226154
VEGA: 19
Homologene: 15690
Or56a4
Name: olfactory receptor family 56 subfamily A member 4
Synonyms: GA_x6K02T2PBJ9-7786441-7785503, Olfr684, MOR40-8P
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244187
Homologene: 133596
Arid5a
Name: AT-rich interaction domain 5A
Synonyms: D430024K22Rik, Mrf1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214855
Homologene: 34940
Dgkb
Name: diacylglycerol kinase, beta
Synonyms: DGK-beta, C630029D13Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217480
VEGA: 12
HGNC: HGNC:2850
Homologene: 37875
Ush1c
Name: USH1 protein network component harmonin
Synonyms: Usher syndrome 1C, 2010016F01Rik, harmonin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72088
Homologene: 77476
Adrb2
Name: adrenergic receptor, beta 2
Synonyms: Badm, beta 2-AR, Adrb-2, beta 2-adrenoceptor, Gpcr7
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 11555
VEGA: 18
HGNC: HGNC:286
Homologene: 30948
Sh2b1
Name: SH2B adaptor protein 1
Synonyms: Sh2bpsm1, Irip, SH2-B, SH2-Bb
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20399
Homologene: 32122
Hipk3
Name: homeodomain interacting protein kinase 3
Synonyms: DYRK6, FIST3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15259
HGNC: HGNC:4915
Homologene: 55923
Ap1m2
Name: adaptor protein complex AP-1, mu 2 subunit
Synonyms: [m]1B, D9Ertd818e, mu1B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11768
VEGA: 9
HGNC: HGNC:558
Homologene: 55906
Vmn1r185
Name: vomeronasal 1 receptor 185
Synonyms: V1re12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171265
Homologene: 74353
Acvrl1
Name: activin A receptor, type II-like 1
Synonyms: Alk-1, Acvrlk1, Alk1, activin receptor-like kinase-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11482
HGNC: HGNC:175
Homologene: 20058
Sult1d1
Name: sulfotransferase family 1D, member 1
Synonyms: tyrosine-ester sulfotransferase, 5033411P13Rik, Sultn
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53315
Homologene: 124464
Rgs6
Name: regulator of G-protein signaling 6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 50779
Homologene: 68385
Vmn1r86
Name: vomeronasal 1 receptor 86
Synonyms: Gm10301
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100312473
Homologene: 74345
Cntnap3
Name: contactin associated protein-like 3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238680
VEGA: 13
Homologene: 129602
P2rx2
Name: purinergic receptor P2X, ligand-gated ion channel, 2
Synonyms: P2X2a, P2x2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231602
Homologene: 14251
Or52r1
Name: olfactory receptor family 52 subfamily R member 1
Synonyms: MOR30-1, Olfr569, GA_x6K02T2PBJ9-5599295-5598351
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259092
Homologene: 17500
Or5t18
Name: olfactory receptor family 5 subfamily T member 18
Synonyms: Olfr141, MOR179-5, GA_x6K02T2Q125-48299679-48298702, K17
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257913
Homologene: 28042
Vmn1r43
Name: vomeronasal 1 receptor 43
Synonyms: V1ra5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113847
Homologene: 130651
Pbxip1
Name: pre B cell leukemia transcription factor interacting protein 1
Synonyms: 4732463H20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229534
Homologene: 10740
Igsf21
Name: immunoglobulin superfamily, member 21
Synonyms: LOC230868
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230868
Homologene: 13153
Mapk10
Name: mitogen-activated protein kinase 10
Synonyms: Serk2, p493F12, C230008H04Rik, JNK3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26414
HGNC: HGNC:6872
Homologene: 56439
Gprin1
Name: G protein-regulated inducer of neurite outgrowth 1
Synonyms: GRIN1, Z16
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26913
Homologene: 8072
Ubqln5
Name: ubiquilin 5
Synonyms: 4931431F19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70980
Homologene: 78030
Cdnf
Name: cerebral dopamine neurotrophic factor
Synonyms: Armetl1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227526
Homologene: 27965
Gtf3c6
Name: general transcription factor IIIC, polypeptide 6, alpha
Synonyms: 2410016F19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67371
VEGA: 10
Homologene: 12121
Or52e19b
Name: olfactory receptor family 52 subfamily E member 19B
Synonyms: MOR32-2, Olfr603, MOR32-14_i, GA_x6K02T2PBJ9-6092550-6092362, Olfr604, GA_x6K02T2PBJ9-6096387-6095449
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259073
Homologene: 121535
Sec11c
Name: SEC11 homolog C, signal peptidase complex subunit
Synonyms: Sec11l3, 1810029G24Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66286
Homologene: 8624
Ttc6
Name: tetratricopeptide repeat domain 6
Synonyms: EG639426, AU024163, 4921506M07Rik, Gm9813, LOC217602
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70846
Homologene: 78002
Or5g24-ps1
Name: olfactory receptor family 5 subfamily G member 24, pseudogene 1
Synonyms: GA_x6K02T2Q125-47112820-47113764, MOR175-6, Olfr1001-ps1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258078
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to A, chromosome 1 at 11,136,804 bp (GRCm38)
  • A to G, chromosome 1 at 36,318,992 bp (GRCm38)
  • C to T, chromosome 2 at 3,521,038 bp (GRCm38)
  • T to C, chromosome 2 at 85,634,023 bp (GRCm38)
  • A to G, chromosome 2 at 86,806,816 bp (GRCm38)
  • T to A, chromosome 2 at 104,433,217 bp (GRCm38)
  • A to G, chromosome 2 at 181,680,450 bp (GRCm38)
  • A to G, chromosome 3 at 89,447,634 bp (GRCm38)
  • T to C, chromosome 3 at 95,546,947 bp (GRCm38)
  • G to A, chromosome 3 at 98,102,352 bp (GRCm38)
  • T to A, chromosome 4 at 140,246,451 bp (GRCm38)
  • A to T, chromosome 4 at 145,170,386 bp (GRCm38)
  • T to A, chromosome 5 at 87,566,095 bp (GRCm38)
  • A to T, chromosome 5 at 102,913,286 bp (GRCm38)
  • A to T, chromosome 5 at 110,340,272 bp (GRCm38)
  • T to A, chromosome 5 at 135,725,743 bp (GRCm38)
  • G to A, chromosome 6 at 89,869,895 bp (GRCm38)
  • A to G, chromosome 6 at 141,994,785 bp (GRCm38)
  • A to G, chromosome 7 at 13,102,334 bp (GRCm38)
  • T to C, chromosome 7 at 20,049,510 bp (GRCm38)
  • T to A, chromosome 7 at 26,611,631 bp (GRCm38)
  • T to C, chromosome 7 at 46,220,510 bp (GRCm38)
  • A to G, chromosome 7 at 102,887,793 bp (GRCm38)
  • T to A, chromosome 7 at 103,383,280 bp (GRCm38)
  • T to C, chromosome 7 at 104,128,778 bp (GRCm38)
  • A to T, chromosome 7 at 105,156,799 bp (GRCm38)
  • T to C, chromosome 7 at 108,523,828 bp (GRCm38)
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp (GRCm38)
  • GACCAGCTCAGCCACGGG to GACCAGCTCAGCCACGGGTACCAGCTCAGCCACGGG, chromosome 7 at 126,467,574 bp (GRCm38)
  • GCCACGGGGACCAGCTC to GCCACGGGGACCAGCTCATCCACGGGGACCAGCTC, chromosome 7 at 126,467,584 bp (GRCm38)
  • C to T, chromosome 7 at 135,172,499 bp (GRCm38)
  • T to C, chromosome 8 at 35,805,202 bp (GRCm38)
  • A to G, chromosome 8 at 120,576,335 bp (GRCm38)
  • A to G, chromosome 8 at 128,726,124 bp (GRCm38)
  • A to G, chromosome 9 at 21,305,639 bp (GRCm38)
  • G to T, chromosome 9 at 22,448,786 bp (GRCm38)
  • A to G, chromosome 9 at 105,774,626 bp (GRCm38)
  • C to T, chromosome 9 at 108,487,167 bp (GRCm38)
  • G to A, chromosome 10 at 40,257,524 bp (GRCm38)
  • T to G, chromosome 11 at 79,547,192 bp (GRCm38)
  • G to A, chromosome 12 at 38,139,658 bp (GRCm38)
  • T to A, chromosome 12 at 57,737,618 bp (GRCm38)
  • T to G, chromosome 12 at 82,651,841 bp (GRCm38)
  • G to T, chromosome 13 at 54,739,570 bp (GRCm38)
  • G to A, chromosome 13 at 64,903,834 bp (GRCm38)
  • C to T, chromosome 14 at 45,657,660 bp (GRCm38)
  • T to C, chromosome 14 at 50,828,972 bp (GRCm38)
  • A to T, chromosome 14 at 80,011,809 bp (GRCm38)
  • A to G, chromosome 15 at 89,160,919 bp (GRCm38)
  • A to T, chromosome 15 at 101,137,043 bp (GRCm38)
  • A to G, chromosome 16 at 37,061,032 bp (GRCm38)
  • A to G, chromosome 16 at 44,013,018 bp (GRCm38)
  • A to G, chromosome 17 at 66,129,917 bp (GRCm38)
  • A to T, chromosome 17 at 66,448,467 bp (GRCm38)
  • T to C, chromosome 18 at 62,179,205 bp (GRCm38)
  • T to A, chromosome 18 at 65,809,497 bp (GRCm38)
  • T to G, chromosome 19 at 45,024,769 bp (GRCm38)
  • A to G, chromosome 19 at 50,225,213 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9398 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069202-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.