Strain Name:
C57BL/6J-MtgxR9404Btlr/Mmmh
Stock Number:
069208-MU
Citation ID:
RRID:MMRRC_069208-MU
Other Names:
R9404 (G1)
Major Collection:

Strain Information

Sbf2
Name: SET binding factor 2
Synonyms: SBF2, 4833411B01Rik, mMTMH1, B430219L04Rik, Mtmr13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319934
HGNC: HGNC:2135
Homologene: 41810
Cdh11
Name: cadherin 11
Synonyms: Cad11, OB-cadherin, osteoblast-cadherin
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12552
HGNC: HGNC:1750
Homologene: 1361
Runx1
Name: runt related transcription factor 1
Synonyms: AML1, Pebp2a2, runt domain, alpha subunit 2, Cbfa2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12394
Homologene: 1331
Ewsr1
Name: Ewing sarcoma breakpoint region 1
Synonyms: Ews
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14030
HGNC: HGNC:3508
Homologene: 134632
Pnn
Name: pinin
Synonyms: D12Ertd512e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18949
VEGA: 12
HGNC: HGNC:9162
Homologene: 37656
Atad5
Name: ATPase family, AAA domain containing 5
Synonyms: LOC237877, C130052G03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237877
Homologene: 32611
Mast4
Name: microtubule associated serine/threonine kinase family member 4
Synonyms: 4930420O11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 328329
Homologene: 42094
Tut7
Name: terminal uridylyl transferase 7
Synonyms: 6030448M23Rik, Tent3b, Zcchc6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 214290
VEGA: 13
Homologene: 51941
Lrba
Name: LPS-responsive beige-like anchor
Synonyms: Lba, D3Ertd775e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80877
HGNC: HGNC:1742
Homologene: 36205
Virma
Name: vir like m6A methyltransferase associated
Synonyms: 1110037F02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66185
Homologene: 41043
Pds5a
Name: PDS5 cohesin associated factor A
Synonyms: E230024D05Rik, 9030416H16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71521
Homologene: 22877
Ptpn23
Name: protein tyrosine phosphatase, non-receptor type 23
Synonyms: PTP-TD14
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 104831
Homologene: 135706
Ube3a
Name: ubiquitin protein ligase E3A
Synonyms: Hpve6a, E6-AP ubiquitin protein ligase, A130086L21Rik, 5830462N02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22215
Homologene: 7988
Trrap
Name: transformation/transcription domain-associated protein
Synonyms: transactivation/transformation-domain associated protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100683
Homologene: 39246
Pcsk9
Name: proprotein convertase subtilisin/kexin type 9
Synonyms: Narc1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100102
Homologene: 17790
Ufl1
Name: UFM1 specific ligase 1
Synonyms: Rcad, Maxer, 1810074P20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67490
Homologene: 9093
Vps8
Name: VPS8 CORVET complex subunit
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 209018
Homologene: 44592
Mmp17
Name: matrix metallopeptidase 17
Synonyms: MT4-MMP, membrane type-4 matrix metalloproteinase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23948
HGNC: HGNC:7163
Homologene: 22669
Oga
Name: O-GlcNAcase
Synonyms: Hy5, 5830447M11Rik, 4833427O07Rik, 2810009A20Rik, Mgea5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76055
VEGA: 19
HGNC: HGNC:7056
Homologene: 8154
Pus10
Name: pseudouridylate synthase 10
Synonyms: 2810013G11Rik, 4933435A13Rik, Ccdc139
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74467
Homologene: 12566
Vps13b
Name: vacuolar protein sorting 13B
Synonyms: 1810042B05Rik, Coh1, C330002D13Rik, 2310042E16Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 666173
VEGA: 15
HGNC: HGNC:2183
Homologene: 49516
Armt1
Name: acidic residue methyltransferase 1
Synonyms: 1700052N19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73419
Homologene: 41557
Themis
Name: thymocyte selection associated
Synonyms: E430004N04Rik, Tsepa, Gasp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 210757
Homologene: 72287
Iqcd
Name: IQ motif containing D
Synonyms: 4933433C09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75732
Homologene: 49921
Hk1
Name: hexokinase 1
Synonyms: Hk-1, mHk1-s, Hk1-s
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15275
HGNC: HGNC:4922
Homologene: 100530
Mavs
Name: mitochondrial antiviral signaling protein
Synonyms: IPS-1, D430028G21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228607
Homologene: 17004
Iqcb1
Name: IQ calmodulin-binding motif containing 1
Synonyms: 6820449I09Rik, NPHP5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 320299
Homologene: 8766
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Zfp418
Name: zinc finger protein 418
Synonyms: A230102I05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232854
Homologene: 119890
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Trak2
Name: trafficking protein, kinesin binding 2
Synonyms: GRIF-1, CALS-C, OIP98, GRIF1, 4733401O11Rik, Als2cr3, 2900022D04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70827
Homologene: 22861
Plekhh2
Name: pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213556
VEGA: 17
Homologene: 35317
Pkdrej
Name: polycystin (PKD) family receptor for egg jelly
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18766
VEGA: 15
HGNC: HGNC:9015
Homologene: 4427
Col27a1
Name: collagen, type XXVII, alpha 1
Synonyms: 5730512J02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 373864
Homologene: 69400
Srgap3
Name: SLIT-ROBO Rho GTPase activating protein 3
Synonyms: Arhgap14, D130026O08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 259302
Homologene: 56686
Gsap
Name: gamma-secretase activating protein
Synonyms: A530088I07Rik, Pion
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 212167
Homologene: 45504
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Ppp6r2
Name: protein phosphatase 6, regulatory subunit 2
Synonyms: 1110033O10Rik, 8430411H09Rik, B230107H12Rik, Pp6r2, Saps2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71474
VEGA: 15
Homologene: 36455
Zfp790
Name: zinc finger protein 790
Synonyms: 6330581L23Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233056
Homologene: 51695
Spaca6
Name: sperm acrosome associated 6
Synonyms: B230206P06Rik, 4930546H06Rik, Ncrna00085
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75202
Homologene: 53443
Rnf185
Name: ring finger protein 185
Synonyms: 1700022N24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 193670
Homologene: 34298
Scn9a
Name: sodium channel, voltage-gated, type IX, alpha
Synonyms: PN1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20274
Homologene: 2237
Myh2
Name: myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms: MyHC-IIa, MHC2A, Myhs-f, Myhs-f1, Myhsf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17882
HGNC: HGNC:7572
Homologene: 23019
Or6d13
Name: olfactory receptor family 6 subfamily D member 13
Synonyms: GA_x54KRFPKN04-58174409-58175392, MOR119-3, Olfr213
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258020
Homologene: 74186
Vmn2r77
Name: vomeronasal 2, receptor 77
Synonyms: EG546983
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546983
Homologene: 115466
Or2aj4
Name: olfactory receptor family 2 subfamily AJ member 4
Synonyms: GA_x54KRFPKG5P-16014972-16014031, MOR273-3P, Olfr169
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258158
Homologene: 128058
Zfp235
Name: zinc finger protein 235
Synonyms: 0610030O19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56525
Homologene: 122146
Megf6
Name: multiple EGF-like-domains 6
Synonyms: 2600001P17Rik, Egfl3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230971
HGNC: HGNC:3232
Homologene: 45412
Spire2
Name: spire type actin nucleation factor 2
Synonyms: Spir-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234857
Homologene: 72212
Sh2b1
Name: SH2B adaptor protein 1
Synonyms: Irip, SH2-Bb, SH2-B, Sh2bpsm1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20399
Homologene: 32122
Parpbp
Name: PARP1 binding protein
Synonyms: 4930547N16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75317
Homologene: 49519
Klhl25
Name: kelch-like 25
Synonyms: 2810402K13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207952
Homologene: 32546
Kcnt2
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240776
Homologene: 16121
Vcpip1
Name: valosin containing protein (p97)/p47 complex interacting protein 1
Synonyms: 5730421J18Rik, 5730538E15Rik, Vcip135
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70675
Homologene: 11814
Ppp2r3a
Name: protein phosphatase 2, regulatory subunit B'', alpha
Synonyms: 3222402P14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235542
HGNC: HGNC:9307
Homologene: 20595
Insl5
Name: insulin-like 5
Synonyms: relaxin/insulin-like factor 2, RIF2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 23919
HGNC: HGNC:6088
Homologene: 48350
Acot11
Name: acyl-CoA thioesterase 11
Synonyms: 1110020M10Rik, 2010309H15Rik, Thea, BFIT1, Them1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329910
Homologene: 11977
Cdk15
Name: cyclin dependent kinase 15
Synonyms: Als2cr7, Pftk2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 271697
Homologene: 64641
Efcab5
Name: EF-hand calcium binding domain 5
Synonyms: 4930563A03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319634
Homologene: 63366
Bbs12
Name: Bardet-Biedl syndrome 12
Synonyms: LOC241950, LOC386537, LOC241950
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 241950
Homologene: 17634
Or4a27
Name: olfactory receptor family 4 subfamily A member 27
Synonyms: GA_x6K02T2Q125-50202854-50201910, MOR225-14, MOR225-10P, Olfr1197
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 433449
Homologene: 123770
Cyp3a11
Name: cytochrome P450, family 3, subfamily a, polypeptide 11
Synonyms: Cyp3a, Pcn, IIIAm1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13112
HGNC: HGNC:2638
Homologene: 133568
Rexo5
Name: RNA exonuclease 5
Synonyms: 2610020H08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434234
Homologene: 12803
Pax5
Name: paired box 5
Synonyms: Pax-5, EBB-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18507
HGNC: HGNC:8619
Homologene: 56419
Krt1
Name: keratin 1
Synonyms: Krt2-1, Krt-2.1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Slc7a11
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 11
Synonyms: System xc, xc, xCT, sut, 9930009M05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26570
Homologene: 22684
Or8g55
Name: olfactory receptor family 8 subfamily G member 55
Synonyms: GA_x6K02T2PVTD-33572803-33573747, MOR171-17, Olfr972
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258603
VEGA: 9
Homologene: 121532
Zfp3
Name: zinc finger protein 3
Synonyms: Fnp-1, Zfp-3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 193043
Homologene: 27406
Or13a26
Name: olfactory receptor family 13 subfamily A member 26
Synonyms: GA_x6K02T2PBJ9-42850324-42851256, MOR253-3, Olfr541
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258964
Homologene: 138322
Pcsk1
Name: proprotein convertase subtilisin/kexin type 1
Synonyms: PC3, prohormone convertase 1/3, Nec-1, Nec1, PC1, SPC3, Phpp-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18548
HGNC: HGNC:8743
Homologene: 379
Tlcd4
Name: TLC domain containing 4
Synonyms: C730036B01Rik, 4930577M16Rik, Tmem56
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99887
Homologene: 45107
Or2a12
Name: olfactory receptor family 2 subfamily A member 12
Synonyms: GA_x6K02T2P3E9-4632269-4631343, MOR261-12, Olfr446
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258292
Homologene: 17179
Gm8225
Name: predicted gene 8225
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 666668
VEGA: 17
Pcdhga2
Name: protocadherin gamma subfamily A, 2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93710
HGNC: HGNC:8700
Homologene: 69262
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 9,747,631 bp (GRCm38)
  • T to C, chromosome 1 at 58,921,137 bp (GRCm38)
  • A to G, chromosome 1 at 59,289,755 bp (GRCm38)
  • T to A, chromosome 1 at 140,425,369 bp (GRCm38)
  • T to C, chromosome 2 at 52,257,776 bp (GRCm38)
  • G to A, chromosome 2 at 66,526,696 bp (GRCm38)
  • A to T, chromosome 2 at 76,754,156 bp (GRCm38)
  • T to A, chromosome 2 at 88,729,207 bp (GRCm38)
  • T to A, chromosome 2 at 131,241,898 bp (GRCm38)
  • T to C, chromosome 3 at 37,319,408 bp (GRCm38)
  • T to C, chromosome 3 at 50,381,039 bp (GRCm38)
  • T to C, chromosome 3 at 86,297,917 bp (GRCm38)
  • T to C, chromosome 3 at 121,235,082 bp (GRCm38)
  • T to A, chromosome 4 at 11,513,626 bp (GRCm38)
  • T to C, chromosome 4 at 25,275,912 bp (GRCm38)
  • G to A, chromosome 4 at 44,645,565 bp (GRCm38)
  • T to C, chromosome 4 at 63,275,941 bp (GRCm38)
  • T to C, chromosome 4 at 103,018,338 bp (GRCm38)
  • C to A, chromosome 4 at 106,454,526 bp (GRCm38)
  • T to C, chromosome 4 at 106,758,312 bp (GRCm38)
  • T to A, chromosome 4 at 154,263,768 bp (GRCm38)
  • A to G, chromosome 5 at 21,269,921 bp (GRCm38)
  • T to A, chromosome 5 at 65,618,964 bp (GRCm38)
  • A to C, chromosome 5 at 120,600,536 bp (GRCm38)
  • A to G, chromosome 5 at 129,605,677 bp (GRCm38)
  • T to C, chromosome 5 at 144,815,415 bp (GRCm38)
  • T to C, chromosome 5 at 145,862,448 bp (GRCm38)
  • T to C, chromosome 6 at 42,927,816 bp (GRCm38)
  • A to T, chromosome 6 at 112,729,655 bp (GRCm38)
  • T to G, chromosome 6 at 116,540,747 bp (GRCm38)
  • A to T, chromosome 7 at 7,182,105 bp (GRCm38)
  • A to T, chromosome 7 at 24,140,437 bp (GRCm38)
  • G to A, chromosome 7 at 29,825,760 bp (GRCm38)
  • A to G, chromosome 7 at 59,287,015 bp (GRCm38)
  • A to C, chromosome 7 at 75,865,405 bp (GRCm38)
  • T to A, chromosome 7 at 86,802,039 bp (GRCm38)
  • T to C, chromosome 7 at 110,441,495 bp (GRCm38)
  • A to G, chromosome 7 at 119,801,319 bp (GRCm38)
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp (GRCm38)
  • TC to TCAGCCACGGGGACCAGCCC, chromosome 7 at 126,467,599 bp (GRCm38)
  • T to A, chromosome 7 at 140,704,809 bp (GRCm38)
  • A to T, chromosome 8 at 102,679,622 bp (GRCm38)
  • C to T, chromosome 8 at 123,363,338 bp (GRCm38)
  • A to T, chromosome 9 at 39,873,412 bp (GRCm38)
  • A to G, chromosome 9 at 101,148,641 bp (GRCm38)
  • T to C, chromosome 9 at 110,386,957 bp (GRCm38)
  • AC to A, chromosome 10 at 4,450,848 bp (GRCm38)
  • A to G, chromosome 10 at 28,789,747 bp (GRCm38)
  • T to A, chromosome 10 at 62,296,080 bp (GRCm38)
  • A to G, chromosome 10 at 88,114,549 bp (GRCm38)
  • A to T, chromosome 11 at 3,432,615 bp (GRCm38)
  • A to G, chromosome 11 at 5,072,940 bp (GRCm38)
  • T to A, chromosome 11 at 23,711,202 bp (GRCm38)
  • A to G, chromosome 11 at 55,253,522 bp (GRCm38)
  • G to T, chromosome 11 at 67,179,628 bp (GRCm38)
  • A to G, chromosome 11 at 70,772,540 bp (GRCm38)
  • G to A, chromosome 11 at 77,132,108 bp (GRCm38)
  • T to C, chromosome 11 at 80,114,238 bp (GRCm38)
  • A to G, chromosome 12 at 59,071,972 bp (GRCm38)
  • A to T, chromosome 13 at 59,799,887 bp (GRCm38)
  • T to G, chromosome 13 at 75,132,223 bp (GRCm38)
  • A to G, chromosome 13 at 102,751,425 bp (GRCm38)
  • A to T, chromosome 15 at 35,876,419 bp (GRCm38)
  • C to A, chromosome 15 at 85,819,069 bp (GRCm38)
  • A to G, chromosome 15 at 89,268,550 bp (GRCm38)
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp (GRCm38)
  • C to T, chromosome 16 at 19,565,981 bp (GRCm38)
  • T to C, chromosome 16 at 21,608,177 bp (GRCm38)
  • T to C, chromosome 16 at 36,851,270 bp (GRCm38)
  • T to C, chromosome 16 at 92,689,027 bp (GRCm38)
  • T to C, chromosome 17 at 17,837,538 bp (GRCm38)
  • T to A, chromosome 17 at 26,543,060 bp (GRCm38)
  • A to T, chromosome 17 at 84,571,040 bp (GRCm38)
  • A to G, chromosome 18 at 37,670,014 bp (GRCm38)
  • CTCGGGTC to CTC, chromosome 19 at 45,754,657 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9404 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069208-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.