Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9430Btlr/Mmmh
Stock Number:
069234-MU
Citation ID:
RRID:MMRRC_069234-MU
Other Names:
R9430 (G1)
Major Collection:

Strain Information

Eri3
Name: exoribonuclease 3
Synonyms: PINT1, Prnpip1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140546
Homologene: 15403
Arid5b
Name: AT-rich interaction domain 5B
Synonyms: 5430435G07Rik, Desrt, Mrf2beta, Mrf2alpha, Mrf2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71371
VEGA: 10
Homologene: 45872
Map1b
Name: microtubule-associated protein 1B
Synonyms: MAP5, Mtap-5, Mtap5, LC1, Mtap1b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17755
VEGA: 13
HGNC: HGNC:6836
Homologene: 38111
Jak2
Name: Janus kinase 2
Synonyms: C81284
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16452
VEGA: 19
HGNC: HGNC:6192
Homologene: 21033
Lyz2
Name: lysozyme 2
Synonyms: Lzp, Lzm, Lys, Lzm-s1, Lyzs, Lysm
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17105
VEGA: 10
HGNC: HGNC:6740
Homologene: 121490
Dusp16
Name: dual specificity phosphatase 16
Synonyms: MKP-7, MKP7, 3830417M17Rik, D6Ertd213e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70686
Homologene: 15604
Slc4a2
Name: solute carrier family 4 (anion exchanger), member 2
Synonyms: B3RP, Ae2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20535
Homologene: 128699
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 54,281,771 bp (GRCm38)
  • A to C, chromosome 1 at 59,192,039 bp (GRCm38)
  • C to T, chromosome 1 at 157,567,324 bp (GRCm38)
  • A to T, chromosome 1 at 183,287,789 bp (GRCm38)
  • A to G, chromosome 2 at 76,771,578 bp (GRCm38)
  • A to T, chromosome 2 at 87,033,909 bp (GRCm38)
  • A to G, chromosome 2 at 93,762,654 bp (GRCm38)
  • C to A, chromosome 2 at 120,904,025 bp (GRCm38)
  • A to T, chromosome 3 at 40,724,866 bp (GRCm38)
  • A to C, chromosome 3 at 57,289,793 bp (GRCm38)
  • A to G, chromosome 3 at 96,706,908 bp (GRCm38)
  • A to G, chromosome 4 at 83,604,125 bp (GRCm38)
  • T to G, chromosome 4 at 117,582,671 bp (GRCm38)
  • T to A, chromosome 4 at 124,742,547 bp (GRCm38)
  • C to T, chromosome 4 at 130,945,967 bp (GRCm38)
  • T to A, chromosome 4 at 132,917,744 bp (GRCm38)
  • C to A, chromosome 4 at 134,167,354 bp (GRCm38)
  • T to C, chromosome 5 at 21,915,107 bp (GRCm38)
  • A to G, chromosome 5 at 24,431,319 bp (GRCm38)
  • T to G, chromosome 5 at 63,807,322 bp (GRCm38)
  • A to G, chromosome 5 at 96,781,392 bp (GRCm38)
  • A to G, chromosome 5 at 110,103,502 bp (GRCm38)
  • A to G, chromosome 5 at 135,755,405 bp (GRCm38)
  • A to G, chromosome 6 at 67,861,457 bp (GRCm38)
  • A to T, chromosome 6 at 91,807,284 bp (GRCm38)
  • A to G, chromosome 6 at 115,016,102 bp (GRCm38)
  • G to T, chromosome 6 at 134,760,866 bp (GRCm38)
  • T to G, chromosome 7 at 28,396,906 bp (GRCm38)
  • T to C, chromosome 7 at 43,676,618 bp (GRCm38)
  • T to C, chromosome 7 at 64,223,698 bp (GRCm38)
  • C to T, chromosome 7 at 67,733,433 bp (GRCm38)
  • A to G, chromosome 7 at 85,566,032 bp (GRCm38)
  • A to T, chromosome 7 at 104,880,997 bp (GRCm38)
  • G to T, chromosome 7 at 105,740,865 bp (GRCm38)
  • G to A, chromosome 7 at 120,028,982 bp (GRCm38)
  • C to T, chromosome 7 at 141,808,832 bp (GRCm38)
  • T to C, chromosome 7 at 143,709,789 bp (GRCm38)
  • CAGCATCTGCTCGGAGCA to CAGCA, chromosome 8 at 26,160,856 bp (GRCm38)
  • A to G, chromosome 8 at 111,630,048 bp (GRCm38)
  • A to T, chromosome 8 at 120,572,310 bp (GRCm38)
  • A to G, chromosome 8 at 124,826,217 bp (GRCm38)
  • T to C, chromosome 9 at 16,376,085 bp (GRCm38)
  • T to C, chromosome 9 at 44,103,273 bp (GRCm38)
  • A to G, chromosome 9 at 56,620,228 bp (GRCm38)
  • T to C, chromosome 9 at 61,927,440 bp (GRCm38)
  • C to T, chromosome 9 at 66,418,503 bp (GRCm38)
  • G to A, chromosome 9 at 78,667,416 bp (GRCm38)
  • T to A, chromosome 9 at 109,609,970 bp (GRCm38)
  • T to A, chromosome 9 at 110,034,692 bp (GRCm38)
  • A to G, chromosome 10 at 39,045,806 bp (GRCm38)
  • C to A, chromosome 10 at 68,186,257 bp (GRCm38)
  • G to T, chromosome 10 at 79,825,841 bp (GRCm38)
  • A to G, chromosome 10 at 94,922,682 bp (GRCm38)
  • A to T, chromosome 10 at 116,113,377 bp (GRCm38)
  • C to A, chromosome 10 at 117,282,172 bp (GRCm38)
  • A to G, chromosome 10 at 127,022,902 bp (GRCm38)
  • G to A, chromosome 11 at 5,834,749 bp (GRCm38)
  • T to A, chromosome 11 at 67,091,900 bp (GRCm38)
  • T to A, chromosome 11 at 67,179,533 bp (GRCm38)
  • A to G, chromosome 11 at 77,818,584 bp (GRCm38)
  • T to A, chromosome 11 at 79,527,697 bp (GRCm38)
  • A to T, chromosome 11 at 120,458,704 bp (GRCm38)
  • T to A, chromosome 12 at 13,321,653 bp (GRCm38)
  • A to T, chromosome 12 at 57,686,407 bp (GRCm38)
  • A to G, chromosome 12 at 73,103,945 bp (GRCm38)
  • T to C, chromosome 13 at 27,714,377 bp (GRCm38)
  • G to T, chromosome 13 at 30,947,604 bp (GRCm38)
  • T to A, chromosome 13 at 99,434,108 bp (GRCm38)
  • A to C, chromosome 13 at 100,539,848 bp (GRCm38)
  • T to A, chromosome 14 at 46,853,874 bp (GRCm38)
  • T to A, chromosome 14 at 56,629,216 bp (GRCm38)
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp (GRCm38)
  • A to T, chromosome 16 at 3,965,532 bp (GRCm38)
  • G to A, chromosome 16 at 44,732,097 bp (GRCm38)
  • T to A, chromosome 16 at 64,926,468 bp (GRCm38)
  • T to C, chromosome 17 at 32,820,212 bp (GRCm38)
  • T to C, chromosome 17 at 34,112,636 bp (GRCm38)
  • A to T, chromosome 19 at 29,287,967 bp (GRCm38)
  • C to T, chromosome 19 at 30,039,259 bp (GRCm38)
  • T to G, chromosome 19 at 38,896,046 bp (GRCm38)
  • C to T, chromosome 19 at 47,050,780 bp (GRCm38)
  • T to C, chromosome 19 at 50,210,770 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9430 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069234-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.