Strain Name:
C57BL/6J-MtgxR9430Btlr/Mmmh
Stock Number:
069234-MU
Citation ID:
RRID:MMRRC_069234-MU
Other Names:
R9430 (G1)
Major Collection:

Strain Information

Eri3
Name: exoribonuclease 3
Synonyms: PINT1, Prnpip1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140546
Homologene: 15403
Arid5b
Name: AT-rich interaction domain 5B
Synonyms: 5430435G07Rik, Desrt, Mrf2beta, Mrf2alpha, Mrf2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71371
VEGA: 10
Homologene: 45872
Map1b
Name: microtubule-associated protein 1B
Synonyms: MAP5, Mtap-5, Mtap5, LC1, Mtap1b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17755
VEGA: 13
HGNC: HGNC:6836
Homologene: 38111
Jak2
Name: Janus kinase 2
Synonyms: C81284
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16452
VEGA: 19
HGNC: HGNC:6192
Homologene: 21033
Lyz2
Name: lysozyme 2
Synonyms: Lzp, Lzm, Lys, Lzm-s1, Lyzs, Lysm
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17105
VEGA: 10
HGNC: HGNC:6740
Homologene: 121490
Dusp16
Name: dual specificity phosphatase 16
Synonyms: MKP-7, MKP7, 3830417M17Rik, D6Ertd213e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70686
Homologene: 15604
Slc4a2
Name: solute carrier family 4 (anion exchanger), member 2
Synonyms: B3RP, Ae2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20535
Homologene: 128699
Map4
Name: microtubule-associated protein 4
Synonyms: MAP 4, Mtap4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17758
HGNC: HGNC:6862
Homologene: 1780
Gse1
Name: genetic suppressor element 1, coiled-coil protein
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382034
Homologene: 40964
Ubr1
Name: ubiquitin protein ligase E3 component n-recognin 1
Synonyms: E3 alpha
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22222
Homologene: 7582
Myo18a
Name: myosin XVIIIA
Synonyms: MyoPDZ
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 360013
Homologene: 7977
Brd2
Name: bromodomain containing 2
Synonyms: Ring3, Frg-1, D17H6S113E, Fsrg1, Rnf3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14312
HGNC: HGNC:1103
Homologene: 74540
Als2
Name: alsin Rho guanine nucleotide exchange factor
Synonyms: 3222402C23Rik, Als2cr6, 9430073A21Rik, Alsin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74018
HGNC: HGNC:443
Homologene: 23264
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Cep85
Name: centrosomal protein 85
Synonyms: 2410030J07Rik, Ccdc21
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70012
Homologene: 11254
Parp4
Name: poly (ADP-ribose) polymerase family, member 4
Synonyms: VPARP, VAULT3, p193, PH5P, E230037B21Rik, Adprtl1, C030027K23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328417
HGNC: HGNC:271
Homologene: 124423
Uhrf2
Name: ubiquitin-like, containing PHD and RING finger domains 2
Synonyms: 2310065A22Rik, Nirf, D130071B19Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 109113
Homologene: 17001
Kif23
Name: kinesin family member 23
Synonyms: 3110001D19Rik, MKLP-1, MKLP1, CHO1, Knsl5, C87313
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71819
VEGA: 9
HGNC: HGNC:6392
Homologene: 11491
Htr1f
Name: 5-hydroxytryptamine (serotonin) receptor 1F
Synonyms: Htr1eb
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15557
VEGA: 16
HGNC: HGNC:5292
Homologene: 37361
Thap1
Name: THAP domain containing, apoptosis associated protein 1
Synonyms: 4833431A01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73754
Homologene: 10005
Zfp799
Name: zinc finger protein 799
Synonyms: 6030490I01Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240064
Homologene: 107106
Lingo1
Name: leucine rich repeat and Ig domain containing 1
Synonyms: UNQ201, LERN1, 4930471K13Rik, LINGO-1, Lrrn6a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235402
Homologene: 41891
Inpp5b
Name: inositol polyphosphate-5-phosphatase B
Synonyms: 75kDa
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16330
HGNC: HGNC:6077
Homologene: 69021
Ext2
Name: exostosin glycosyltransferase 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14043
HGNC: HGNC:3513
Homologene: 345
Ccdc171
Name: coiled-coil domain containing 171
Synonyms: 4930418J05Rik, A330015D16Rik, 4930473A06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320226
Homologene: 27942
Paf1
Name: Paf1, RNA polymerase II complex component
Synonyms: 5730511K23Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54624
Homologene: 5441
Nepro
Name: nucleolus and neural progenitor protein
Synonyms: BC027231
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 212547
Homologene: 9127
Nbas
Name: neuroblastoma amplified sequence
Synonyms: 4933425L03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71169
VEGA: 12
Homologene: 41073
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Tamm41
Name: TAM41 mitochondrial translocator assembly and maintenance homolog
Synonyms: 1500001M20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68971
Homologene: 13754
Reln
Name: reelin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19699
HGNC: HGNC:9957
Homologene: 3699
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Sorcs1
Name: sortilin-related VPS10 domain containing receptor 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 58178
Homologene: 10967
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC234973, LOC382129, 9430076A06Rik, D430038H04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Lama4
Name: laminin, alpha 4
Synonyms: laminin [a]4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16775
HGNC: HGNC:6484
Homologene: 37604
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Trpm1
Name: transient receptor potential cation channel, subfamily M, member 1
Synonyms: Mlsn1, 4732499L03Rik, melastatin, LTRPC1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17364
HGNC: HGNC:7146
Homologene: 19940
Synm
Name: synemin, intermediate filament protein
Synonyms: 4930412K21Rik, Synemin, Dmn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233335
Homologene: 9081
Myh2
Name: myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms: MyHC-IIa, MHC2A, Myhs-f, Myhs-f1, Myhsf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17882
HGNC: HGNC:7572
Homologene: 23019
Vmn2r70
Name: vomeronasal 2, receptor 70
Synonyms: EG620835
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 670940
Homologene: 115466
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235505
Homologene: 25183
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Myh3
Name: myosin, heavy polypeptide 3, skeletal muscle, embryonic
Synonyms: MyHC-emb, Myhs-e, Myhse
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17883
HGNC: HGNC:7573
Homologene: 20553
Or5be3
Name: olfactory receptor family 5 subfamily BE member 3
Synonyms: GA_x6K02T2Q125-48521031-48520093, MOR172-7, MOR0-6P, Olfr1105
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258085
Homologene: 121541
Nlrc3
Name: NLR family, CARD domain containing 3
Synonyms: D230007K08Rik, Caterpiller 16.2, CLR16.2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268857
Homologene: 18720
Ccdc150
Name: coiled-coil domain containing 150
Synonyms: 4930511H11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78016
Homologene: 15814
Plcxd1
Name: phosphatidylinositol-specific phospholipase C, X domain containing 1
Synonyms: LOC231597, A330045H12Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 403178
Homologene: 138628
Trim67
Name: tripartite motif-containing 67
Synonyms: D130049O21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330863
Homologene: 45699
Fam76a
Name: family with sequence similarity 76, member A
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230789
Homologene: 27071
Nwd2
Name: NACHT and WD repeat domain containing 2
Synonyms: B830017A01Rik, 3110047P20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319807
Homologene: 14974
Tsfm
Name: Ts translation elongation factor, mitochondrial
Synonyms: 9430024O13Rik, EF-Tsmt, EF-TS, 2310050B20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66399
Homologene: 4184
Fbxw24
Name: F-box and WD-40 domain protein 24
Synonyms: Gm5162
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382106
Homologene: 110776
Cgrrf1
Name: cell growth regulator with ring finger domain 1
Synonyms: 1110038G02Rik, CGR19, 1810009H17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68755
Homologene: 4789
Tm4sf1
Name: transmembrane 4 superfamily member 1
Synonyms: 12A8 target antigen, L6 antigen, L6, M3s1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17112
Homologene: 7409
Sec16b
Name: SEC16 homolog B, endoplasmic reticulum export factor
Synonyms: Rgpr-p117, Rgpr, Lztr2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 89867
Homologene: 13227
Pcgf6
Name: polycomb group ring finger 6
Synonyms: Mel18 and Bmi1-like RING finger protein, MBLR, 4933407A11Rik, Rnf134
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71041
VEGA: 19
Homologene: 12378
Plxnc1
Name: plexin C1
Synonyms: vespr, 2510048K12Rik, CD232
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 54712
HGNC: HGNC:9106
Homologene: 4211
Osbpl5
Name: oxysterol binding protein-like 5
Synonyms: Obph1, ORP5, 1110006M06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 79196
Homologene: 98024
Grip2
Name: glutamate receptor interacting protein 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243547
Homologene: 16327
Matn1
Name: matrilin 1, cartilage matrix protein
Synonyms: matrilin-1, CMP, Crtm, Mat1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17180
HGNC: HGNC:6907
Homologene: 1783
4933416C03Rik
Name: RIKEN cDNA 4933416C03 gene
Type: Gene
Species: Mouse
Chromosome: 10
Or52n3
Name: olfactory receptor family 52 subfamily N member 3
Synonyms: GA_x6K02T2PBJ9-7509539-7510489, MOR34-7, Olfr665
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258810
Homologene: 110477
Mfrp
Name: membrane frizzled-related protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 259172
Homologene: 12866
Krt1
Name: keratin 1
Synonyms: Krt2-1, Krt-2.1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Ldhd
Name: lactate dehydrogenase D
Synonyms: D8Bwg1320e, 4733401P21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52815
Homologene: 5536
Prl7d1
Name: prolactin family 7, subfamily d, member 1
Synonyms: PRP, PLF-RP, Plfr
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18814
Homologene: 7894
Ctu1
Name: cytosolic thiouridylase subunit 1
Synonyms: Atpbd3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233189
Homologene: 102140
Polm
Name: polymerase (DNA directed), mu
Synonyms: Tdt-N, B230309I03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54125
HGNC: HGNC:9185
Homologene: 41170
Ocln
Name: occludin
Synonyms: Ocl
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18260
HGNC: HGNC:8104
Homologene: 1905
Brox
Name: BRO1 domain and CAAX motif containing
Synonyms: 0610010K06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71678
Homologene: 13499
Tbc1d12
Name: TBC1D12: TBC1 domain family, member 12
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 209478
VEGA: 19
Homologene: 50835
Hus1b
Name: HUS1 checkpoint clamp component B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210554
Homologene: 51833
Misp
Name: mitotic spindle positioning
Synonyms: 9130017N09Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 78906
VEGA: 10
Homologene: 49933
Ccdc137
Name: coiled-coil domain containing 137
Synonyms: 3110023B02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67291
Homologene: 34992
Styxl1
Name: serine/threonine/tyrosine interacting-like 1
Synonyms: 1700011C14Rik, Dusp24
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76571
Homologene: 9378
Evi2a
Name: ecotropic viral integration site 2a
Synonyms: Evi-2, Evi2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14017
HGNC: HGNC:3499
Homologene: 49234
Slc25a31
Name: solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31
Synonyms: 1700034J06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73333
Homologene: 69485
Six4
Name: sine oculis-related homeobox 4
Synonyms: AREC3, TrexBF
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20474
Homologene: 69089
Ilk
Name: integrin linked kinase
Synonyms: ESTM24
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16202
HGNC: HGNC:6040
Homologene: 3318
Igkv17-127
Name: immunoglobulin kappa variable 17-127
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243433
HGNC: HGNC:5835
Ttc6
Name: tetratricopeptide repeat domain 6
Synonyms: LOC217602, EG639426, Gm9813, 4921506M07Rik, AU024163
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70846
Homologene: 78002
Nudt17
Name: nudix hydrolase 17
Synonyms: 2410015C20Rik, nudix (nucleoside diphosphate linked moiety X)-type motif 17
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 78373
Homologene: 45961
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 54,281,771 bp (GRCm38)
  • A to C, chromosome 1 at 59,192,039 bp (GRCm38)
  • C to T, chromosome 1 at 157,567,324 bp (GRCm38)
  • A to T, chromosome 1 at 183,287,789 bp (GRCm38)
  • A to G, chromosome 2 at 76,771,578 bp (GRCm38)
  • A to T, chromosome 2 at 87,033,909 bp (GRCm38)
  • A to G, chromosome 2 at 93,762,654 bp (GRCm38)
  • C to A, chromosome 2 at 120,904,025 bp (GRCm38)
  • A to T, chromosome 3 at 40,724,866 bp (GRCm38)
  • A to C, chromosome 3 at 57,289,793 bp (GRCm38)
  • A to G, chromosome 3 at 96,706,908 bp (GRCm38)
  • A to G, chromosome 4 at 83,604,125 bp (GRCm38)
  • T to G, chromosome 4 at 117,582,671 bp (GRCm38)
  • T to A, chromosome 4 at 124,742,547 bp (GRCm38)
  • C to T, chromosome 4 at 130,945,967 bp (GRCm38)
  • T to A, chromosome 4 at 132,917,744 bp (GRCm38)
  • C to A, chromosome 4 at 134,167,354 bp (GRCm38)
  • T to C, chromosome 5 at 21,915,107 bp (GRCm38)
  • A to G, chromosome 5 at 24,431,319 bp (GRCm38)
  • T to G, chromosome 5 at 63,807,322 bp (GRCm38)
  • A to G, chromosome 5 at 96,781,392 bp (GRCm38)
  • A to G, chromosome 5 at 110,103,502 bp (GRCm38)
  • A to G, chromosome 5 at 135,755,405 bp (GRCm38)
  • A to G, chromosome 6 at 67,861,457 bp (GRCm38)
  • A to T, chromosome 6 at 91,807,284 bp (GRCm38)
  • A to G, chromosome 6 at 115,016,102 bp (GRCm38)
  • G to T, chromosome 6 at 134,760,866 bp (GRCm38)
  • T to G, chromosome 7 at 28,396,906 bp (GRCm38)
  • T to C, chromosome 7 at 43,676,618 bp (GRCm38)
  • T to C, chromosome 7 at 64,223,698 bp (GRCm38)
  • C to T, chromosome 7 at 67,733,433 bp (GRCm38)
  • A to G, chromosome 7 at 85,566,032 bp (GRCm38)
  • A to T, chromosome 7 at 104,880,997 bp (GRCm38)
  • G to T, chromosome 7 at 105,740,865 bp (GRCm38)
  • G to A, chromosome 7 at 120,028,982 bp (GRCm38)
  • C to T, chromosome 7 at 141,808,832 bp (GRCm38)
  • T to C, chromosome 7 at 143,709,789 bp (GRCm38)
  • CAGCATCTGCTCGGAGCA to CAGCA, chromosome 8 at 26,160,856 bp (GRCm38)
  • A to G, chromosome 8 at 111,630,048 bp (GRCm38)
  • A to T, chromosome 8 at 120,572,310 bp (GRCm38)
  • A to G, chromosome 8 at 124,826,217 bp (GRCm38)
  • T to C, chromosome 9 at 16,376,085 bp (GRCm38)
  • T to C, chromosome 9 at 44,103,273 bp (GRCm38)
  • A to G, chromosome 9 at 56,620,228 bp (GRCm38)
  • T to C, chromosome 9 at 61,927,440 bp (GRCm38)
  • C to T, chromosome 9 at 66,418,503 bp (GRCm38)
  • G to A, chromosome 9 at 78,667,416 bp (GRCm38)
  • T to A, chromosome 9 at 109,609,970 bp (GRCm38)
  • T to A, chromosome 9 at 110,034,692 bp (GRCm38)
  • A to G, chromosome 10 at 39,045,806 bp (GRCm38)
  • C to A, chromosome 10 at 68,186,257 bp (GRCm38)
  • G to T, chromosome 10 at 79,825,841 bp (GRCm38)
  • A to G, chromosome 10 at 94,922,682 bp (GRCm38)
  • A to T, chromosome 10 at 116,113,377 bp (GRCm38)
  • C to A, chromosome 10 at 117,282,172 bp (GRCm38)
  • A to G, chromosome 10 at 127,022,902 bp (GRCm38)
  • G to A, chromosome 11 at 5,834,749 bp (GRCm38)
  • T to A, chromosome 11 at 67,091,900 bp (GRCm38)
  • T to A, chromosome 11 at 67,179,533 bp (GRCm38)
  • A to G, chromosome 11 at 77,818,584 bp (GRCm38)
  • T to A, chromosome 11 at 79,527,697 bp (GRCm38)
  • A to T, chromosome 11 at 120,458,704 bp (GRCm38)
  • T to A, chromosome 12 at 13,321,653 bp (GRCm38)
  • A to T, chromosome 12 at 57,686,407 bp (GRCm38)
  • A to G, chromosome 12 at 73,103,945 bp (GRCm38)
  • T to C, chromosome 13 at 27,714,377 bp (GRCm38)
  • G to T, chromosome 13 at 30,947,604 bp (GRCm38)
  • T to A, chromosome 13 at 99,434,108 bp (GRCm38)
  • A to C, chromosome 13 at 100,539,848 bp (GRCm38)
  • T to A, chromosome 14 at 46,853,874 bp (GRCm38)
  • T to A, chromosome 14 at 56,629,216 bp (GRCm38)
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp (GRCm38)
  • A to T, chromosome 16 at 3,965,532 bp (GRCm38)
  • G to A, chromosome 16 at 44,732,097 bp (GRCm38)
  • T to A, chromosome 16 at 64,926,468 bp (GRCm38)
  • T to C, chromosome 17 at 32,820,212 bp (GRCm38)
  • T to C, chromosome 17 at 34,112,636 bp (GRCm38)
  • A to T, chromosome 19 at 29,287,967 bp (GRCm38)
  • C to T, chromosome 19 at 30,039,259 bp (GRCm38)
  • T to G, chromosome 19 at 38,896,046 bp (GRCm38)
  • C to T, chromosome 19 at 47,050,780 bp (GRCm38)
  • T to C, chromosome 19 at 50,210,770 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9430 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069234-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.