Strain Name:
C57BL/6J-MtgxR9431Btlr/Mmmh
Stock Number:
069235-MU
Citation ID:
RRID:MMRRC_069235-MU
Other Names:
R9431 (G1)
Major Collection:

Strain Information

D630045J12Rik
Name: RIKEN cDNA D630045J12 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330286
Homologene: 19782
Slc12a5
Name: solute carrier family 12, member 5
Synonyms: KCC2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 57138
Homologene: 10665
Creb1
Name: cAMP responsive element binding protein 1
Synonyms: Creb-1, 2310001E10Rik, Creb, 3526402H21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12912
HGNC: HGNC:2345
Homologene: 3223
Morc3
Name: microrchidia 3
Synonyms: 1110051N18Rik, 1110051N18Rik, D16Jhu32e, Zcwcc3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 338467
Homologene: 32257
Slc37a3
Name: solute carrier family 37 (glycerol-3-phosphate transporter), member 3
Synonyms: 2610507O21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72144
Homologene: 41740
Kdm5a
Name: lysine demethylase 5A
Synonyms: RBP2, Jarid1a, Rbbp2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 214899
HGNC: HGNC:9886
Homologene: 3419
Fbxl17
Name: F-box and leucine-rich repeat protein 17
Synonyms: 6330576B01Rik, C130023C01Rik, Fbxo13, Fbx13
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50758
Homologene: 79859
Tsc22d1
Name: TSC22 domain family, member 1
Synonyms: TSC-22, Egr5, Tgfb1i4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21807
Homologene: 7573
Evi5
Name: ecotropic viral integration site 5
Synonyms: NB4S
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14020
HGNC: HGNC:3501
Homologene: 121902
Focad
Name: focadhesin
Synonyms: BC057079
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230393
Homologene: 9842
Cdc73
Name: cell division cycle 73, Paf1/RNA polymerase II complex component
Synonyms: Hrpt2, C130030P16Rik, 8430414L16Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214498
Homologene: 11571
Arhgap32
Name: Rho GTPase activating protein 32
Synonyms: PX-RICS, GC-GAP, p200RhoGAP, Grit, 3426406O18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330914
Homologene: 8812
Tiam1
Name: T cell lymphoma invasion and metastasis 1
Synonyms: D16Ium10, D16Ium10e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21844
Homologene: 2443
Rad17
Name: RAD17 checkpoint clamp loader component
Synonyms: 9430035O09Rik, MmRad24
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19356
VEGA: 13
HGNC: HGNC:9807
Homologene: 32117
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: LOC381341, Dnahc7, Dnahc7a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 627872
Homologene: 41287
Lipc
Name: lipase, hepatic
Synonyms: Hpl, HL
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15450
VEGA: 9
HGNC: HGNC:6619
Homologene: 199
Slc39a8
Name: solute carrier family 39 (metal ion transporter), member 8
Synonyms: ZIP8, 4933419D20Rik, BIGM103
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67547
Homologene: 11155
Kank1
Name: KN motif and ankyrin repeat domains 1
Synonyms: D330024H06Rik, A930031B09Rik, Ankrd15
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107351
Homologene: 17706
Ibsp
Name: integrin binding sialoprotein
Synonyms: BSP, Bsp, bone sialoprotein, Bsp2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15891
HGNC: HGNC:5341
Homologene: 3644
Cpq
Name: carboxypeptidase Q
Synonyms: HLS2, Pgcp, 2610034C17Rik, 1190003P12Rik, Lal-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54381
VEGA: 15
Homologene: 9401
Patl1
Name: protein associated with topoisomerase II homolog 1 (yeast)
Synonyms: Pat1b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225929
VEGA: 19
Homologene: 82269
Trim37
Name: tripartite motif-containing 37
Synonyms: 2810004E07Rik, MUL, 1110032A10Rik, TEF3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68729
HGNC: HGNC:7523
Homologene: 9084
Btbd16
Name: BTB domain containing 16
Synonyms: E330040A16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330660
Homologene: 77327
Slc45a2
Name: solute carrier family 45, member 2
Synonyms: Dbr, Matp, Oca4, Aim1, blanc-sale, bls, dominant brown, Aim-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22293
Homologene: 9412
Ttn
Name: titin
Synonyms: 2310074I15Rik, D330041I19Rik, 2310057K23Rik, connectin, 2310036G12Rik, shru, D830007G01Rik, L56, 1100001C23Rik, mdm
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Fat2
Name: FAT atypical cadherin 2
Synonyms: mKIAA0811, Fath2, LOC245827, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Zbtb41
Name: zinc finger and BTB domain containing 41
Synonyms: 8430415N23Rik, 9830132G07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226470
Homologene: 27795
Dock10
Name: dedicator of cytokinesis 10
Synonyms: Jr5, ZIZ3, 9330153B10Rik, Zizimin3, A630054M16Rik, Jr4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210293
Homologene: 45952
Mroh2b
Name: maestro heat-like repeat family member 2B
Synonyms: 4930455B06Rik, Heatr7b2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223825
VEGA: 15
Homologene: 128807
Slc4a11
Name: solute carrier family 4, sodium bicarbonate transporter-like, member 11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269356
Homologene: 12931
Slc13a4
Name: solute carrier family 13 (sodium/sulfate symporters), member 4
Synonyms: SUT-1, 9630060C05Rik, SUT1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243755
Homologene: 69125
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: E130113P14Rik, bl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
St8sia3
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3
Synonyms: Siat8c, ST8SiaIII
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20451
Homologene: 8285
Trpv3
Name: transient receptor potential cation channel, subfamily V, member 3
Synonyms: 1110036I10Rik, Nh, VRL3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 246788
Homologene: 17040
Vmn2r27
Name: vomeronasal 2, receptor27
Synonyms: EG232367
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232367
Whamm
Name: WAS protein homolog associated with actin, golgi membranes and microtubules
Synonyms: Whdc1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434204
Homologene: 45851
Vwa5b2
Name: von Willebrand factor A domain containing 5B2
Synonyms: EG328644
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 328643
Homologene: 28056
Kcnh1
Name: potassium voltage-gated channel, subfamily H (eag-related), member 1
Synonyms: Eag1, ether a go-go, Kv10.1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16510
HGNC: HGNC:6250
Homologene: 68242
Fktn
Name: fukutin
Synonyms: Fukutin, Fcmd
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 246179
HGNC: HGNC:3622
Homologene: 31402
Hdac9
Name: histone deacetylase 9
Synonyms: Mitr, D030072B18Rik, HDRP, Hdac7b
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 79221
Homologene: 128578
Rigi
Name: RNA sensor RIG-I
Synonyms: 6430573D20Rik, RIG-I, DEAD (Asp-Glu-Ala-Asp) box polypeptide 58, Ddx58
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230073
Homologene: 32215
Or6ae1
Name: olfactory receptor family 6 subfamily AE member 1
Synonyms: Olfr522, GA_x6K02T2PBJ9-42315125-42314187, MOR103-5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258954
Homologene: 62435
Mdfic2
Name: MyoD family inhibitor domain containing 2
Synonyms: Gm765, LOC330390
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330390
Homologene: 66631
Slc30a9
Name: solute carrier family 30 (zinc transporter), member 9
Synonyms: 2310024J23Rik, GAC63
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 109108
HGNC: HGNC:1329
Homologene: 4627
Gnas
Name: GNAS complex locus
Synonyms: G alpha s, Gnasxl, Nesp, Nesp55, Oedsml, Gsa, neuroendocrine-specific Golgi protein p55 isoform 1, P2, P3, Galphas, XLalphas, P1, Gs alpha, Gs-alpha, SCG6, Gnas1, Nespl
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14683
HGNC: HGNC:4392
Homologene: 55534
Or2y1b
Name: olfactory receptor family 2 subfamily Y member 1B
Synonyms: MOR256-55, GA_x6K02T2QP88-6117098-6116163, L45, Olfr10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18307
Homologene: 81347
Slc22a6
Name: solute carrier family 22 (organic anion transporter), member 6
Synonyms: Orctl1, mOat1, NKT, Oat1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18399
VEGA: 19
Homologene: 16813
Sertad2
Name: SERTA domain containing 2
Synonyms: SEI-2, Sei2, Trip-Br2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 58172
Homologene: 8843
Slc7a12
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 12
Synonyms: XAT1, Asc-2, asc-type amino acid transporter 2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 140918
Homologene: 76812
2310003L06Rik
Name: RIKEN cDNA 2310003L06 gene
Type: Gene
Species: Mouse
Chromosome: 5
Or2d2b
Name: olfactory receptor family 2 subfamily D member 2B
Synonyms: Olfr715b, Gm10081, EG384732
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384732
HGNC: HGNC:8244
Homologene: 81541
Or5h27
Name: olfactory receptor family 5 subfamily H member 27, pseudogene 1
Synonyms: Olfr197, MOR183-3, GA_x54KRFPKG5P-55400292-55399363
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258477
Homologene: 36984
Or13c7e-ps1
Name: olfactory receptor family 13 subfamily C member 7E, pseudogene 1
Synonyms: Olfr37d, GA_x6K02T2N78B-16154374-16155336, MTPCR52, MOR262-11, Olfr29-ps1, Olfr29, mOR37d
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 29848
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 53,411,653 bp (GRCm38)
  • C to A, chromosome 1 at 64,576,254 bp (GRCm38)
  • T to C, chromosome 1 at 80,605,876 bp (GRCm38)
  • C to T, chromosome 1 at 139,423,043 bp (GRCm38)
  • T to A, chromosome 1 at 143,670,002 bp (GRCm38)
  • A to G, chromosome 1 at 192,418,815 bp (GRCm38)
  • C to T, chromosome 2 at 76,714,335 bp (GRCm38)
  • C to T, chromosome 2 at 130,691,744 bp (GRCm38)
  • T to C, chromosome 2 at 164,990,258 bp (GRCm38)
  • T to C, chromosome 2 at 174,298,033 bp (GRCm38)
  • G to A, chromosome 3 at 14,480,975 bp (GRCm38)
  • T to C, chromosome 3 at 135,858,162 bp (GRCm38)
  • A to G, chromosome 4 at 40,229,545 bp (GRCm38)
  • A to C, chromosome 4 at 43,781,682 bp (GRCm38)
  • G to A, chromosome 4 at 53,734,854 bp (GRCm38)
  • A to G, chromosome 4 at 88,403,346 bp (GRCm38)
  • A to G, chromosome 5 at 67,347,935 bp (GRCm38)
  • A to C, chromosome 5 at 87,972,466 bp (GRCm38)
  • A to T, chromosome 5 at 96,753,014 bp (GRCm38)
  • A to T, chromosome 5 at 104,309,301 bp (GRCm38)
  • A to G, chromosome 5 at 107,842,284 bp (GRCm38)
  • A to G, chromosome 6 at 35,301,807 bp (GRCm38)
  • G to T, chromosome 6 at 38,196,879 bp (GRCm38)
  • T to C, chromosome 6 at 39,347,429 bp (GRCm38)
  • T to C, chromosome 6 at 98,238,203 bp (GRCm38)
  • T to A, chromosome 6 at 120,415,292 bp (GRCm38)
  • T to C, chromosome 6 at 124,191,897 bp (GRCm38)
  • C to T, chromosome 6 at 140,646,868 bp (GRCm38)
  • A to G, chromosome 7 at 81,586,287 bp (GRCm38)
  • T to A, chromosome 7 at 107,106,129 bp (GRCm38)
  • C to T, chromosome 7 at 130,815,786 bp (GRCm38)
  • T to A, chromosome 7 at 140,162,029 bp (GRCm38)
  • C to A, chromosome 9 at 32,259,167 bp (GRCm38)
  • T to C, chromosome 9 at 70,816,607 bp (GRCm38)
  • A to T, chromosome 11 at 20,648,425 bp (GRCm38)
  • A to G, chromosome 11 at 49,317,632 bp (GRCm38)
  • T to C, chromosome 11 at 55,252,012 bp (GRCm38)
  • A to T, chromosome 11 at 73,287,399 bp (GRCm38)
  • T to A, chromosome 11 at 87,186,431 bp (GRCm38)
  • G to A, chromosome 12 at 34,390,328 bp (GRCm38)
  • A to G, chromosome 13 at 100,643,566 bp (GRCm38)
  • TCAGCAGCAGCAGCAGCAGCAGCAGCA to TCAGCAGCAGCAGCAGCAGCAGCA, chromosome 14 at 76,417,267 bp (GRCm38)
  • A to T, chromosome 15 at 4,934,470 bp (GRCm38)
  • G to A, chromosome 15 at 11,025,919 bp (GRCm38)
  • C to T, chromosome 15 at 33,249,932 bp (GRCm38)
  • C to T, chromosome 16 at 20,604,296 bp (GRCm38)
  • A to G, chromosome 16 at 59,185,727 bp (GRCm38)
  • A to G, chromosome 16 at 89,798,030 bp (GRCm38)
  • C to A, chromosome 16 at 93,870,883 bp (GRCm38)
  • A to G, chromosome 17 at 55,939,536 bp (GRCm38)
  • G to A, chromosome 17 at 63,080,494 bp (GRCm38)
  • T to A, chromosome 18 at 64,265,569 bp (GRCm38)
  • A to G, chromosome 19 at 8,621,232 bp (GRCm38)
  • A to G, chromosome 19 at 11,921,451 bp (GRCm38)
  • C to A, chromosome 19 at 25,410,502 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9431 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069235-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.