Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9431Btlr/Mmmh
Stock Number:
069235-MU
Citation ID:
RRID:MMRRC_069235-MU
Other Names:
R9431 (G1)
Major Collection:

Strain Information

D630045J12Rik
Name: RIKEN cDNA D630045J12 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330286
Homologene: 19782
Slc12a5
Name: solute carrier family 12, member 5
Synonyms: KCC2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 57138
Homologene: 10665
Creb1
Name: cAMP responsive element binding protein 1
Synonyms: Creb-1, Creb, 2310001E10Rik, 3526402H21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12912
HGNC: HGNC:2345
Homologene: 3223
Morc3
Name: microrchidia 3
Synonyms: 1110051N18Rik, D16Jhu32e, 1110051N18Rik, Zcwcc3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 338467
Homologene: 32257
Slc37a3
Name: solute carrier family 37 (glycerol-3-phosphate transporter), member 3
Synonyms: 2610507O21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72144
Homologene: 41740
Kdm5a
Name: lysine demethylase 5A
Synonyms: RBP2, Rbbp2, Jarid1a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 214899
HGNC: HGNC:9886
Homologene: 3419
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 53,411,653 bp (GRCm38)
  • C to A, chromosome 1 at 64,576,254 bp (GRCm38)
  • T to C, chromosome 1 at 80,605,876 bp (GRCm38)
  • C to T, chromosome 1 at 139,423,043 bp (GRCm38)
  • T to A, chromosome 1 at 143,670,002 bp (GRCm38)
  • A to G, chromosome 1 at 192,418,815 bp (GRCm38)
  • C to T, chromosome 2 at 76,714,335 bp (GRCm38)
  • C to T, chromosome 2 at 130,691,744 bp (GRCm38)
  • T to C, chromosome 2 at 164,990,258 bp (GRCm38)
  • T to C, chromosome 2 at 174,298,033 bp (GRCm38)
  • G to A, chromosome 3 at 14,480,975 bp (GRCm38)
  • T to C, chromosome 3 at 135,858,162 bp (GRCm38)
  • A to G, chromosome 4 at 40,229,545 bp (GRCm38)
  • A to C, chromosome 4 at 43,781,682 bp (GRCm38)
  • G to A, chromosome 4 at 53,734,854 bp (GRCm38)
  • A to G, chromosome 4 at 88,403,346 bp (GRCm38)
  • A to G, chromosome 5 at 67,347,935 bp (GRCm38)
  • A to C, chromosome 5 at 87,972,466 bp (GRCm38)
  • A to T, chromosome 5 at 96,753,014 bp (GRCm38)
  • A to T, chromosome 5 at 104,309,301 bp (GRCm38)
  • A to G, chromosome 5 at 107,842,284 bp (GRCm38)
  • A to G, chromosome 6 at 35,301,807 bp (GRCm38)
  • G to T, chromosome 6 at 38,196,879 bp (GRCm38)
  • T to C, chromosome 6 at 39,347,429 bp (GRCm38)
  • T to C, chromosome 6 at 98,238,203 bp (GRCm38)
  • T to A, chromosome 6 at 120,415,292 bp (GRCm38)
  • T to C, chromosome 6 at 124,191,897 bp (GRCm38)
  • C to T, chromosome 6 at 140,646,868 bp (GRCm38)
  • A to G, chromosome 7 at 81,586,287 bp (GRCm38)
  • T to A, chromosome 7 at 107,106,129 bp (GRCm38)
  • C to T, chromosome 7 at 130,815,786 bp (GRCm38)
  • T to A, chromosome 7 at 140,162,029 bp (GRCm38)
  • C to A, chromosome 9 at 32,259,167 bp (GRCm38)
  • T to C, chromosome 9 at 70,816,607 bp (GRCm38)
  • A to T, chromosome 11 at 20,648,425 bp (GRCm38)
  • A to G, chromosome 11 at 49,317,632 bp (GRCm38)
  • T to C, chromosome 11 at 55,252,012 bp (GRCm38)
  • A to T, chromosome 11 at 73,287,399 bp (GRCm38)
  • T to A, chromosome 11 at 87,186,431 bp (GRCm38)
  • G to A, chromosome 12 at 34,390,328 bp (GRCm38)
  • A to G, chromosome 13 at 100,643,566 bp (GRCm38)
  • TCAGCAGCAGCAGCAGCAGCAGCAGCA to TCAGCAGCAGCAGCAGCAGCAGCA, chromosome 14 at 76,417,267 bp (GRCm38)
  • A to T, chromosome 15 at 4,934,470 bp (GRCm38)
  • G to A, chromosome 15 at 11,025,919 bp (GRCm38)
  • C to T, chromosome 15 at 33,249,932 bp (GRCm38)
  • C to T, chromosome 16 at 20,604,296 bp (GRCm38)
  • A to G, chromosome 16 at 59,185,727 bp (GRCm38)
  • A to G, chromosome 16 at 89,798,030 bp (GRCm38)
  • C to A, chromosome 16 at 93,870,883 bp (GRCm38)
  • A to G, chromosome 17 at 55,939,536 bp (GRCm38)
  • G to A, chromosome 17 at 63,080,494 bp (GRCm38)
  • T to A, chromosome 18 at 64,265,569 bp (GRCm38)
  • A to G, chromosome 19 at 8,621,232 bp (GRCm38)
  • A to G, chromosome 19 at 11,921,451 bp (GRCm38)
  • C to A, chromosome 19 at 25,410,502 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9431 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069235-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.