Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9440Btlr/Mmmh
Stock Number:
069244-MU
Citation ID:
RRID:MMRRC_069244-MU
Other Names:
R9440 (G1)
Major Collection:

Strain Information

Vps33a
Name: VPS33A CORVET/HOPS core subunit
Synonyms: bf, 3830421M04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77573
Homologene: 11294
Morc3
Name: microrchidia 3
Synonyms: 1110051N18Rik, D16Jhu32e, 1110051N18Rik, Zcwcc3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 338467
Homologene: 32257
Lrch4
Name: leucine-rich repeats and calponin homology (CH) domain containing 4
Synonyms: 2900069C24Rik, LRRN4, LRN, 2810008P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231798
HGNC: HGNC:6691
Homologene: 20532
Plxna1
Name: plexin A1
Synonyms: NOV, Plxn1, 2600013D04Rik, PlexA1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18844
HGNC: HGNC:9099
Homologene: 56426
Bms1
Name: BMS1, ribosome biogenesis factor
Synonyms: Bms1l
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213895
Homologene: 7065
Smc4
Name: structural maintenance of chromosomes 4
Synonyms: 2500002A22Rik, Smc4l1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70099
Homologene: 4015
Trip4
Name: thyroid hormone receptor interactor 4
Synonyms: ASC-1, 4930558E03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56404
Homologene: 9426
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 90,779,346 bp (GRCm38)
  • A to G, chromosome 1 at 155,226,215 bp (GRCm38)
  • A to G, chromosome 2 at 25,565,588 bp (GRCm38)
  • A to G, chromosome 2 at 29,065,697 bp (GRCm38)
  • T to C, chromosome 2 at 70,711,125 bp (GRCm38)
  • A to T, chromosome 2 at 153,905,994 bp (GRCm38)
  • AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG to AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG, chromosome 2 at 180,595,057 bp (GRCm38)
  • T to C, chromosome 2 at 180,741,297 bp (GRCm38)
  • T to A, chromosome 3 at 69,008,122 bp (GRCm38)
  • T to C, chromosome 3 at 108,374,886 bp (GRCm38)
  • C to A, chromosome 3 at 131,325,069 bp (GRCm38)
  • T to C, chromosome 3 at 142,566,574 bp (GRCm38)
  • T to C, chromosome 3 at 152,128,069 bp (GRCm38)
  • T to C, chromosome 4 at 115,636,384 bp (GRCm38)
  • T to C, chromosome 4 at 134,074,291 bp (GRCm38)
  • A to T, chromosome 5 at 31,471,015 bp (GRCm38)
  • T to A, chromosome 5 at 114,246,024 bp (GRCm38)
  • A to T, chromosome 5 at 123,564,984 bp (GRCm38)
  • G to A, chromosome 5 at 137,637,789 bp (GRCm38)
  • A to G, chromosome 6 at 3,516,724 bp (GRCm38)
  • T to TCCG, chromosome 6 at 4,756,451 bp (GRCm38)
  • A to G, chromosome 6 at 5,429,817 bp (GRCm38)
  • A to T, chromosome 6 at 39,805,430 bp (GRCm38)
  • A to T, chromosome 6 at 42,596,972 bp (GRCm38)
  • T to C, chromosome 6 at 56,985,430 bp (GRCm38)
  • T to C, chromosome 6 at 89,341,930 bp (GRCm38)
  • C to A, chromosome 6 at 90,345,371 bp (GRCm38)
  • A to T, chromosome 6 at 118,405,256 bp (GRCm38)
  • A to G, chromosome 6 at 126,864,628 bp (GRCm38)
  • C to A, chromosome 6 at 129,906,723 bp (GRCm38)
  • G to A, chromosome 7 at 3,653,561 bp (GRCm38)
  • C to A, chromosome 7 at 66,419,244 bp (GRCm38)
  • A to G, chromosome 7 at 108,322,830 bp (GRCm38)
  • A to G, chromosome 8 at 33,582,245 bp (GRCm38)
  • A to G, chromosome 9 at 31,096,549 bp (GRCm38)
  • T to C, chromosome 9 at 65,852,952 bp (GRCm38)
  • G to A, chromosome 9 at 120,018,137 bp (GRCm38)
  • T to C, chromosome 10 at 77,862,077 bp (GRCm38)
  • T to C, chromosome 10 at 79,890,982 bp (GRCm38)
  • A to G, chromosome 11 at 97,338,489 bp (GRCm38)
  • T to A, chromosome 14 at 53,649,475 bp (GRCm38)
  • T to C, chromosome 15 at 76,360,864 bp (GRCm38)
  • C to T, chromosome 15 at 79,126,959 bp (GRCm38)
  • A to C, chromosome 16 at 14,120,332 bp (GRCm38)
  • A to T, chromosome 16 at 15,635,311 bp (GRCm38)
  • C to G, chromosome 16 at 87,719,715 bp (GRCm38)
  • A to T, chromosome 16 at 90,929,944 bp (GRCm38)
  • A to G, chromosome 16 at 93,853,087 bp (GRCm38)
  • G to A, chromosome 17 at 24,280,478 bp (GRCm38)
  • G to T, chromosome 17 at 26,126,292 bp (GRCm38)
  • A to G, chromosome 17 at 71,126,334 bp (GRCm38)
  • G to T, chromosome 18 at 35,653,165 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9440 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069244-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.