Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9444Btlr/Mmmh
Stock Number:
069248-MU
Citation ID:
RRID:MMRRC_069248-MU
Other Names:
R9444 (G1)
Major Collection:

Strain Information

Sema3e
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E
Synonyms: Semah
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20349
Homologene: 8247
Drd2
Name: dopamine receptor D2
Synonyms: D2 receptor, D2R, Drd-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13489
VEGA: 9
HGNC: HGNC:3023
Homologene: 22561
Ntrk3
Name: neurotrophic tyrosine kinase, receptor, type 3
Synonyms: TrkC
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18213
HGNC: HGNC:8033
Homologene: 49183
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Card11
Name: caspase recruitment domain family, member 11
Synonyms: CARMA1, BIMP3, 2410011D02Rik, 0610008L17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 108723
Homologene: 13024
Pzp2
Name: PZP alpha-2-macroglobulin like 2
Synonyms: Pzp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11287
Homologene: 104112
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 14,755,490 bp (GRCm38)
  • A to T, chromosome 1 at 39,670,316 bp (GRCm38)
  • T to C, chromosome 1 at 116,804,663 bp (GRCm38)
  • T to A, chromosome 2 at 6,018,944 bp (GRCm38)
  • T to A, chromosome 2 at 41,123,718 bp (GRCm38)
  • C to A, chromosome 2 at 55,112,916 bp (GRCm38)
  • T to A, chromosome 2 at 86,806,142 bp (GRCm38)
  • T to C, chromosome 2 at 111,645,787 bp (GRCm38)
  • C to A, chromosome 2 at 120,664,933 bp (GRCm38)
  • A to C, chromosome 2 at 137,094,477 bp (GRCm38)
  • A to G, chromosome 3 at 53,652,844 bp (GRCm38)
  • CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA to CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA, chromosome 3 at 105,986,525 bp (GRCm38)
  • G to T, chromosome 3 at 141,801,448 bp (GRCm38)
  • T to C, chromosome 4 at 43,030,442 bp (GRCm38)
  • C to T, chromosome 4 at 96,723,958 bp (GRCm38)
  • A to G, chromosome 5 at 14,252,611 bp (GRCm38)
  • T to C, chromosome 5 at 114,245,959 bp (GRCm38)
  • T to A, chromosome 5 at 140,908,638 bp (GRCm38)
  • T to A, chromosome 6 at 91,071,903 bp (GRCm38)
  • T to C, chromosome 6 at 95,566,493 bp (GRCm38)
  • T to C, chromosome 6 at 128,510,399 bp (GRCm38)
  • T to G, chromosome 6 at 136,959,361 bp (GRCm38)
  • T to C, chromosome 6 at 146,953,226 bp (GRCm38)
  • G to A, chromosome 7 at 78,461,057 bp (GRCm38)
  • A to G, chromosome 7 at 98,093,491 bp (GRCm38)
  • A to G, chromosome 7 at 126,585,968 bp (GRCm38)
  • A to G, chromosome 8 at 16,158,236 bp (GRCm38)
  • T to C, chromosome 8 at 64,016,089 bp (GRCm38)
  • T to C, chromosome 8 at 69,882,896 bp (GRCm38)
  • A to G, chromosome 9 at 39,394,069 bp (GRCm38)
  • T to A, chromosome 9 at 44,106,143 bp (GRCm38)
  • T to C, chromosome 9 at 49,407,047 bp (GRCm38)
  • C to T, chromosome 9 at 72,110,758 bp (GRCm38)
  • A to G, chromosome 9 at 86,756,104 bp (GRCm38)
  • A to G, chromosome 10 at 74,642,344 bp (GRCm38)
  • G to T, chromosome 10 at 78,197,778 bp (GRCm38)
  • T to C, chromosome 11 at 43,485,834 bp (GRCm38)
  • G to A, chromosome 11 at 103,618,020 bp (GRCm38)
  • A to G, chromosome 11 at 119,434,797 bp (GRCm38)
  • A to C, chromosome 12 at 21,325,535 bp (GRCm38)
  • G to A, chromosome 12 at 116,407,243 bp (GRCm38)
  • T to A, chromosome 13 at 56,776,155 bp (GRCm38)
  • A to C, chromosome 14 at 30,107,784 bp (GRCm38)
  • A to G, chromosome 14 at 47,250,867 bp (GRCm38)
  • T to C, chromosome 14 at 50,084,412 bp (GRCm38)
  • T to C, chromosome 14 at 50,950,595 bp (GRCm38)
  • T to A, chromosome 14 at 70,966,311 bp (GRCm38)
  • A to G, chromosome 15 at 44,554,657 bp (GRCm38)
  • T to C, chromosome 15 at 76,500,569 bp (GRCm38)
  • C to T, chromosome 15 at 78,527,344 bp (GRCm38)
  • T to C, chromosome 15 at 81,237,718 bp (GRCm38)
  • T to C, chromosome 15 at 100,011,926 bp (GRCm38)
  • T to C, chromosome 16 at 23,613,086 bp (GRCm38)
  • C to A, chromosome 16 at 57,628,092 bp (GRCm38)
  • T to C, chromosome 16 at 59,027,655 bp (GRCm38)
  • C to T, chromosome 16 at 91,495,479 bp (GRCm38)
  • T to A, chromosome 16 at 93,810,239 bp (GRCm38)
  • T to C, chromosome 16 at 96,053,980 bp (GRCm38)
  • T to A, chromosome 17 at 13,361,241 bp (GRCm38)
  • A to T, chromosome 17 at 56,000,907 bp (GRCm38)
  • A to T, chromosome 17 at 63,471,460 bp (GRCm38)
  • A to T, chromosome 18 at 6,052,909 bp (GRCm38)
  • A to G, chromosome 19 at 34,121,290 bp (GRCm38)
  • T to C, chromosome 19 at 44,086,946 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9444 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069248-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.