Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9467Btlr/Mmmh
Stock Number:
069270-MU
Citation ID:
RRID:MMRRC_069270-MU
Other Names:
R9467 (G1)
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Cdh3
Name: cadherin 3
Synonyms: P-cadherin, Cadp, Pcad
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12560
HGNC: HGNC:1762
Homologene: 20425
Sema7a
Name: sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A
Synonyms: Semaphorin K1, CDw108, Semal, 2900057C09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20361
VEGA: 9
Homologene: 2678
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Acap2
Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Synonyms: 9530039J15Rik, Centb2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78618
VEGA: 16
Homologene: 8182
Clptm1
Name: cleft lip and palate associated transmembrane protein 1
Synonyms: N14, HS9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56457
HGNC: HGNC:2087
Homologene: 37464
Relch
Name: RAB11 binding and LisH domain, coiled-coil and HEAT repeat containing
Synonyms: 2310035C23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227446
Homologene: 10834
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 105,741,314 bp (GRCm38)
  • C to T, chromosome 1 at 138,066,222 bp (GRCm38)
  • A to G, chromosome 1 at 162,803,669 bp (GRCm38)
  • C to T, chromosome 1 at 164,130,105 bp (GRCm38)
  • A to C, chromosome 2 at 68,593,590 bp (GRCm38)
  • A to G, chromosome 2 at 85,042,266 bp (GRCm38)
  • G to T, chromosome 2 at 85,690,282 bp (GRCm38)
  • A to T, chromosome 2 at 146,129,229 bp (GRCm38)
  • T to C, chromosome 2 at 174,644,996 bp (GRCm38)
  • A to G, chromosome 3 at 94,582,416 bp (GRCm38)
  • C to A, chromosome 4 at 115,753,011 bp (GRCm38)
  • T to A, chromosome 4 at 117,880,926 bp (GRCm38)
  • T to C, chromosome 4 at 129,432,526 bp (GRCm38)
  • T to C, chromosome 5 at 62,730,557 bp (GRCm38)
  • A to G, chromosome 6 at 70,143,707 bp (GRCm38)
  • C to T, chromosome 6 at 76,496,632 bp (GRCm38)
  • A to T, chromosome 6 at 129,656,400 bp (GRCm38)
  • A to G, chromosome 6 at 131,220,107 bp (GRCm38)
  • T to C, chromosome 7 at 19,637,524 bp (GRCm38)
  • T to A, chromosome 7 at 22,842,716 bp (GRCm38)
  • G to A, chromosome 7 at 44,312,918 bp (GRCm38)
  • A to G, chromosome 7 at 46,909,024 bp (GRCm38)
  • A to G, chromosome 7 at 62,349,155 bp (GRCm38)
  • GCGGCGGCG to GCGGCGGCGACGGCGGCG, chromosome 7 at 97,579,913 bp (GRCm38)
  • G to T, chromosome 7 at 98,710,141 bp (GRCm38)
  • T to A, chromosome 7 at 108,508,583 bp (GRCm38)
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp (GRCm38)
  • CAGCCACGGGGACCAGCT to CAGCCACGGGGACCAGCTAAGCCACGGGGACCAGCT, chromosome 7 at 126,467,582 bp (GRCm38)
  • T to C, chromosome 7 at 127,540,359 bp (GRCm38)
  • A to G, chromosome 8 at 61,515,230 bp (GRCm38)
  • A to T, chromosome 8 at 106,539,793 bp (GRCm38)
  • T to C, chromosome 9 at 18,597,035 bp (GRCm38)
  • T to A, chromosome 9 at 57,957,325 bp (GRCm38)
  • A to G, chromosome 9 at 88,367,363 bp (GRCm38)
  • C to T, chromosome 9 at 108,294,509 bp (GRCm38)
  • G to A, chromosome 9 at 109,038,644 bp (GRCm38)
  • G to T, chromosome 9 at 119,142,584 bp (GRCm38)
  • G to T, chromosome 10 at 88,804,528 bp (GRCm38)
  • C to T, chromosome 10 at 116,322,485 bp (GRCm38)
  • T to C, chromosome 11 at 11,801,483 bp (GRCm38)
  • A to T, chromosome 11 at 29,819,076 bp (GRCm38)
  • AGCTGCTGCTGCTGCTGCTGCTGCTG to AGCTGCTGCTGCTGCTGCTGCTGCTGCTG, chromosome 11 at 62,433,611 bp (GRCm38)
  • CTG to CTGGTG, chromosome 11 at 62,433,622 bp (GRCm38)
  • G to A, chromosome 11 at 72,916,425 bp (GRCm38)
  • G to T, chromosome 11 at 108,942,956 bp (GRCm38)
  • T to C, chromosome 12 at 69,208,945 bp (GRCm38)
  • T to C, chromosome 13 at 11,556,604 bp (GRCm38)
  • C to T, chromosome 13 at 120,172,525 bp (GRCm38)
  • A to G, chromosome 14 at 77,029,584 bp (GRCm38)
  • A to G, chromosome 15 at 3,328,024 bp (GRCm38)
  • A to T, chromosome 15 at 28,366,147 bp (GRCm38)
  • A to G, chromosome 15 at 39,084,294 bp (GRCm38)
  • C to T, chromosome 15 at 91,191,622 bp (GRCm38)
  • T to C, chromosome 15 at 102,223,554 bp (GRCm38)
  • A to G, chromosome 16 at 31,111,083 bp (GRCm38)
  • T to C, chromosome 16 at 93,884,506 bp (GRCm38)
  • G to T, chromosome 17 at 19,067,255 bp (GRCm38)
  • A to G, chromosome 17 at 45,516,484 bp (GRCm38)
  • T to A, chromosome 17 at 48,463,628 bp (GRCm38)
  • T to A, chromosome 18 at 36,993,790 bp (GRCm38)
  • G to C, chromosome 18 at 46,560,681 bp (GRCm38)
  • A to T, chromosome 19 at 12,108,949 bp (GRCm38)
  • T to A, chromosome 19 at 24,953,320 bp (GRCm38)
  • A to G, chromosome 19 at 55,192,661 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9467 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069270-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.