Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9487Btlr/Mmmh
Stock Number:
069290-MU
Citation ID:
RRID:MMRRC_069290-MU
Other Names:
R9487 (G1)
Major Collection:

Strain Information

Sp4
Name: trans-acting transcription factor 4
Synonyms: HF1-b, HF-1b, 5730497N03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20688
VEGA: 12
Homologene: 2341
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Cdkn1b
Name: cyclin dependent kinase inhibitor 1B
Synonyms: p27Kip1, p27
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12576
HGNC: HGNC:1785
Homologene: 2999
Usp47
Name: ubiquitin specific peptidase 47
Synonyms: 4930502N04Rik, A630020C16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74996
Homologene: 9929
Nsrp1
Name: nuclear speckle regulatory protein 1
Synonyms: NSpr70, Ccdc55
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237859
Homologene: 134095
Bop1
Name: block of proliferation 1
Synonyms: Erb1p
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12181
VEGA: 15
Homologene: 6612
Zcchc8
Name: zinc finger, CCHC domain containing 8
Synonyms: 5730565F05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70650
Homologene: 32349
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 9,880,391 bp (GRCm38)
  • T to A, chromosome 1 at 38,019,370 bp (GRCm38)
  • T to G, chromosome 1 at 38,045,479 bp (GRCm38)
  • CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT to CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT, chromosome 1 at 40,327,310 bp (GRCm38)
  • C to T, chromosome 1 at 53,182,506 bp (GRCm38)
  • G to T, chromosome 1 at 58,248,938 bp (GRCm38)
  • T to G, chromosome 1 at 67,034,222 bp (GRCm38)
  • G to A, chromosome 1 at 75,197,952 bp (GRCm38)
  • A to T, chromosome 1 at 87,147,994 bp (GRCm38)
  • T to C, chromosome 1 at 136,627,405 bp (GRCm38)
  • C to T, chromosome 1 at 173,683,395 bp (GRCm38)
  • A to T, chromosome 1 at 191,011,632 bp (GRCm38)
  • T to C, chromosome 2 at 22,241,051 bp (GRCm38)
  • T to A, chromosome 2 at 86,347,502 bp (GRCm38)
  • T to C, chromosome 2 at 89,482,412 bp (GRCm38)
  • T to C, chromosome 2 at 89,657,387 bp (GRCm38)
  • T to C, chromosome 2 at 93,762,611 bp (GRCm38)
  • T to C, chromosome 2 at 114,104,047 bp (GRCm38)
  • T to C, chromosome 2 at 164,893,475 bp (GRCm38)
  • A to G, chromosome 3 at 30,896,765 bp (GRCm38)
  • T to A, chromosome 3 at 53,653,484 bp (GRCm38)
  • T to C, chromosome 3 at 59,247,932 bp (GRCm38)
  • A to T, chromosome 4 at 43,542,893 bp (GRCm38)
  • G to A, chromosome 4 at 58,070,517 bp (GRCm38)
  • G to A, chromosome 4 at 120,463,087 bp (GRCm38)
  • A to G, chromosome 4 at 145,081,299 bp (GRCm38)
  • G to T, chromosome 4 at 156,043,159 bp (GRCm38)
  • A to G, chromosome 5 at 112,342,899 bp (GRCm38)
  • A to G, chromosome 5 at 123,709,237 bp (GRCm38)
  • A to T, chromosome 5 at 140,760,583 bp (GRCm38)
  • T to C, chromosome 5 at 142,451,634 bp (GRCm38)
  • T to C, chromosome 6 at 85,347,931 bp (GRCm38)
  • T to C, chromosome 6 at 134,920,852 bp (GRCm38)
  • A to G, chromosome 6 at 145,174,531 bp (GRCm38)
  • T to G, chromosome 7 at 3,611,664 bp (GRCm38)
  • T to C, chromosome 7 at 15,971,792 bp (GRCm38)
  • A to G, chromosome 7 at 57,508,125 bp (GRCm38)
  • A to G, chromosome 7 at 100,481,916 bp (GRCm38)
  • A to G, chromosome 7 at 102,431,050 bp (GRCm38)
  • A to T, chromosome 7 at 108,031,956 bp (GRCm38)
  • A to G, chromosome 7 at 112,077,856 bp (GRCm38)
  • T to C, chromosome 8 at 43,569,419 bp (GRCm38)
  • A to G, chromosome 8 at 111,126,293 bp (GRCm38)
  • G to A, chromosome 9 at 15,084,534 bp (GRCm38)
  • G to A, chromosome 9 at 18,484,978 bp (GRCm38)
  • G to A, chromosome 9 at 38,143,570 bp (GRCm38)
  • A to C, chromosome 9 at 39,669,315 bp (GRCm38)
  • A to T, chromosome 9 at 62,762,889 bp (GRCm38)
  • G to T, chromosome 9 at 122,775,642 bp (GRCm38)
  • T to A, chromosome 10 at 75,131,599 bp (GRCm38)
  • T to A, chromosome 10 at 81,240,135 bp (GRCm38)
  • A to G, chromosome 10 at 107,494,212 bp (GRCm38)
  • G to A, chromosome 10 at 128,397,759 bp (GRCm38)
  • C to A, chromosome 11 at 6,506,913 bp (GRCm38)
  • T to C, chromosome 11 at 29,174,697 bp (GRCm38)
  • T to G, chromosome 11 at 49,095,793 bp (GRCm38)
  • C to T, chromosome 11 at 58,308,939 bp (GRCm38)
  • T to C, chromosome 11 at 69,515,791 bp (GRCm38)
  • A to T, chromosome 11 at 75,432,668 bp (GRCm38)
  • G to A, chromosome 11 at 77,046,288 bp (GRCm38)
  • A to T, chromosome 11 at 84,814,705 bp (GRCm38)
  • A to T, chromosome 11 at 115,469,912 bp (GRCm38)
  • T to C, chromosome 11 at 120,605,424 bp (GRCm38)
  • T to A, chromosome 12 at 29,994,553 bp (GRCm38)
  • G to A, chromosome 12 at 65,106,614 bp (GRCm38)
  • T to C, chromosome 12 at 118,299,124 bp (GRCm38)
  • A to G, chromosome 13 at 3,930,674 bp (GRCm38)
  • T to C, chromosome 13 at 92,131,251 bp (GRCm38)
  • A to T, chromosome 14 at 30,123,462 bp (GRCm38)
  • C to G, chromosome 14 at 30,559,838 bp (GRCm38)
  • T to C, chromosome 14 at 30,559,839 bp (GRCm38)
  • A to G, chromosome 14 at 50,829,230 bp (GRCm38)
  • A to C, chromosome 14 at 51,195,614 bp (GRCm38)
  • G to A, chromosome 14 at 55,678,321 bp (GRCm38)
  • A to G, chromosome 14 at 70,556,437 bp (GRCm38)
  • A to G, chromosome 14 at 70,556,765 bp (GRCm38)
  • A to G, chromosome 15 at 76,453,876 bp (GRCm38)
  • T to G, chromosome 15 at 76,498,198 bp (GRCm38)
  • T to A, chromosome 16 at 17,771,799 bp (GRCm38)
  • A to G, chromosome 16 at 18,250,950 bp (GRCm38)
  • T to A, chromosome 16 at 87,729,845 bp (GRCm38)
  • T to A, chromosome 17 at 19,081,234 bp (GRCm38)
  • C to T, chromosome 17 at 25,965,379 bp (GRCm38)
  • C to A, chromosome 17 at 33,176,574 bp (GRCm38)
  • T to C, chromosome 17 at 36,366,531 bp (GRCm38)
  • A to T, chromosome 17 at 37,482,533 bp (GRCm38)
  • A to T, chromosome 18 at 20,047,219 bp (GRCm38)
  • A to G, chromosome 18 at 63,777,868 bp (GRCm38)
  • A to C, chromosome 19 at 5,497,708 bp (GRCm38)
  • C to A, chromosome 19 at 34,248,465 bp (GRCm38)
  • C to A, chromosome 19 at 41,585,246 bp (GRCm38)
  • G to A, chromosome 19 at 43,818,032 bp (GRCm38)
  • T to C, chromosome 19 at 44,992,632 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9487 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069290-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.