Strain Name:
C57BL/6J-MtgxR9487Btlr/Mmmh
Stock Number:
069290-MU
Citation ID:
RRID:MMRRC_069290-MU
Other Names:
R9487 (G1)
Major Collection:

Strain Information

Sp4
Name: trans-acting transcription factor 4
Synonyms: HF1-b, HF-1b, 5730497N03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20688
VEGA: 12
Homologene: 2341
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Cdkn1b
Name: cyclin dependent kinase inhibitor 1B
Synonyms: p27Kip1, p27
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12576
HGNC: HGNC:1785
Homologene: 2999
Usp47
Name: ubiquitin specific peptidase 47
Synonyms: 4930502N04Rik, A630020C16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74996
Homologene: 9929
Nsrp1
Name: nuclear speckle regulatory protein 1
Synonyms: NSpr70, Ccdc55
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237859
Homologene: 134095
Bop1
Name: block of proliferation 1
Synonyms: Erb1p
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12181
VEGA: 15
Homologene: 6612
Zcchc8
Name: zinc finger, CCHC domain containing 8
Synonyms: 5730565F05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70650
Homologene: 32349
Wdr7
Name: WD repeat domain 7
Synonyms: TGF-beta resistance associated gene, TRAG
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 104082
VEGA: 18
Homologene: 11408
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Snx32
Name: sorting nexin 32
Synonyms: Snx6b, B930037P14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225861
VEGA: 19
Homologene: 62637
Hsf1
Name: heat shock factor 1
Synonyms: heat shock transcription factor 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15499
VEGA: 15
HGNC: HGNC:5224
Homologene: 74556
Aqr
Name: aquarius
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11834
Homologene: 7629
Gna12
Name: guanine nucleotide binding protein, alpha 12
Synonyms: Galpha12
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14673
HGNC: HGNC:4380
Homologene: 22398
Zfp281
Name: zinc finger protein 281
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226442
Homologene: 8270
Ecel1
Name: endothelin converting enzyme-like 1
Synonyms: DINE, XCE
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13599
HGNC: HGNC:3147
Homologene: 3549
Hr
Name: lysine demethylase and nuclear receptor corepressor
Synonyms: N, ba, rh, rh-bmh, bldy
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 15460
HGNC: HGNC:5172
Homologene: 3774
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Zfp335
Name: zinc finger protein 335
Synonyms: 1810045J01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329559
Homologene: 11129
Flvcr1
Name: feline leukemia virus subgroup C cellular receptor 1
Synonyms: 9630055N22Rik, Mfsd7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226844
Homologene: 56661
Sgk3
Name: serum/glucocorticoid regulated kinase 3
Synonyms: fy, cytokine-independent survival kinase, Cisk, 2510015P22Rik, A330005P07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170755
Homologene: 56582
Bcr
Name: BCR activator of RhoGEF and GTPase
Synonyms: 5133400C09Rik, breakpoint cluster region
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 110279
VEGA: 10
HGNC: HGNC:1014
Homologene: 3192
Stim1
Name: stromal interaction molecule 1
Synonyms: SIM
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20866
Homologene: 20681
Ext2
Name: exostosin glycosyltransferase 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14043
HGNC: HGNC:3513
Homologene: 345
Bach1
Name: BTB and CNC homology 1, basic leucine zipper transcription factor 1
Synonyms: 6230421P05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12013
HGNC: HGNC:935
Homologene: 916
Tln1
Name: talin 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21894
Homologene: 21267
Foxk1
Name: forkhead box K1
Synonyms: Mnf, A630048H08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17425
Homologene: 82414
Scmh1
Name: sex comb on midleg homolog 1
Synonyms: Scml3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 29871
Homologene: 32146
Ppp4r3b
Name: protein phosphatase 4 regulatory subunit 3B
Synonyms: Smek2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104570
Homologene: 68886
Bicra
Name: BRD4 interacting chromatin remodeling complex associated protein
Synonyms: Gltscr1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243842
HGNC: HGNC:4332
Homologene: 9250
Eif5b
Name: eukaryotic translation initiation factor 5B
Synonyms: IF2, A030003E17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226982
Homologene: 134613
Fancm
Name: Fanconi anemia, complementation group M
Synonyms: C730036B14Rik, D12Ertd364e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104806
VEGA: 12
Homologene: 35378
Ucp3
Name: uncoupling protein 3 (mitochondrial, proton carrier)
Synonyms: UCP-3, Slc25a9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22229
Homologene: 2517
Slc39a5
Name: solute carrier family 39 (metal ion transporter), member 5
Synonyms: 2010205A06Rik, 1810013D05Rik, Zip5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72002
VEGA: 10
Homologene: 57083
Trmt2a
Name: TRM2 tRNA methyltransferase 2A
Synonyms: Htf9c
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15547
Homologene: 7374
Itga11
Name: integrin alpha 11
Synonyms: 4732459H24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319480
HGNC: HGNC:6136
Homologene: 8151
Acta2
Name: actin alpha 2, smooth muscle, aorta
Synonyms: Actvs, a-SMA, 0610041G09Rik, SMalphaA, alphaSMA, SMAalpha
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11475
VEGA: 19
HGNC: HGNC:130
Homologene: 133938
Med12l
Name: mediator complex subunit 12-like
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329650
Homologene: 43143
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 4833413O10Rik, D430029O09Rik, 1110021D17Rik, Polydom
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 64817
Homologene: 23386
Gabra5
Name: gamma-aminobutyric acid type A receptor subunit alpha 5
Synonyms: A230018I05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 110886
HGNC: HGNC:4079
Homologene: 20219
Myo1g
Name: myosin IG
Synonyms: E430002D17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 246177
Homologene: 27996
Hephl1
Name: hephaestin-like 1
Synonyms: LOC244698, Zp, zyklopen, thd, cw
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244698
Homologene: 9112
Myo3a
Name: myosin IIIA
Synonyms: 9030416P08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 667663
HGNC: HGNC:7601
Homologene: 49486
Mbd3l1
Name: methyl-CpG binding domain protein 3-like 1
Synonyms: 1700070G05Rik, Mbd3l, 1700095H13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73503
VEGA: 9
Homologene: 12502
Cacna1d
Name: calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms: D-LTCC, Cchl1a, Cchl1a2, Cacnl1a2, 8430418G19Rik, Cav1.3alpha1, C79217
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12289
VEGA: 14
HGNC: HGNC:1391
Homologene: 578
Ifi208
Name: interferon activated gene 208
Synonyms: E430029J22Rik, Pydc3, Pyr-rv1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100033459
HGNC: HGNC:5395
Homologene: 115929
Oscar
Name: osteoclast associated receptor
Synonyms: mOSCAR
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232790
Homologene: 77042
Myf6
Name: myogenic factor 6
Synonyms: MRF4, herculin, bHLHc4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17878
VEGA: 10
HGNC: HGNC:7566
Homologene: 1850
Pxdn
Name: peroxidasin
Synonyms: 2310075M15Rik, VPO1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 69675
Homologene: 33907
Topaz1
Name: testis and ovary specific PAZ domain containing 1
Synonyms: Gm9524
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 671232
VEGA: 9
Homologene: 19835
Il1rl2
Name: interleukin 1 receptor-like 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107527
HGNC: HGNC:5999
Homologene: 2860
Slc16a5
Name: solute carrier family 16 (monocarboxylic acid transporters), member 5
Synonyms: MCT5, A130015N09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217316
Homologene: 20985
Gmpr2
Name: guanosine monophosphate reductase 2
Synonyms: 5730544D12Rik, 1810008P16Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105446
VEGA: 14
HGNC: HGNC:4377
Homologene: 22983
Or4a77
Name: olfactory receptor family 4 subfamily A member 77
Synonyms: GA_x6K02T2Q125-51098877-51097933, MOR231-7, Olfr1250
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258967
Homologene: 128094
Or4a69
Name: olfactory receptor family 4 subfamily A member 69
Synonyms: GA_x6K02T2Q125-50926215-50925271, MOR231-14, Olfr1241
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258447
Homologene: 74067
Ifi47
Name: interferon gamma inducible protein 47
Synonyms: 47kDa, IRG-47, Iigp4, Igrd
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15953
Homologene: 49169
Serpinf2
Name: serine (or cysteine) peptidase inhibitor, clade F, member 2
Synonyms: alpha 2 antiplasmin, Pli
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18816
HGNC: HGNC:9075
Homologene: 719
Vmn2r98
Name: vomeronasal 2, receptor 98
Synonyms: EG224552
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224552
Homologene: 115024
Or8k53
Name: olfactory receptor family 8 subfamily K member 53
Synonyms: GA_x6K02T2Q125-47819205-47818258, MOR186-1, Olfr1055
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259023
Homologene: 131140
Aox4
Name: aldehyde oxidase 4
Synonyms: AOH2, 2310003G12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71872
Homologene: 70273
Tkt
Name: transketolase
Synonyms: p68
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21881
Homologene: 68154
H2-M2
Name: histocompatibility 2, M region locus 2
Synonyms: H-2M2, Thy19.4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14990
Homologene: 133732
Abcc2
Name: ATP-binding cassette, sub-family member 2
Synonyms: multidrug resistance protein 2, Mrp2, Cmoat
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12780
HGNC: HGNC:53
Homologene: 68052
Adam26a
Name: ADAM metallopeptidase domain 26A
Synonyms: Dtgn4, Adam26
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13525
Homologene: 128363
Ankzf1
Name: ankyrin repeat and zinc finger domain containing 1
Synonyms: 1300008P06Rik, 2810025E10Rik, D1Ertd161e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 52231
Homologene: 41225
Mrm1
Name: mitochondrial rRNA methyltransferase 1
Synonyms: A530065E19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217038
Homologene: 40307
Irag2
Name: inositol 1,4,5-triphosphate receptor associated 2
Synonyms: Jaw1, D6Int7, D6Int8, D6Int5, D6Int4, D6Int3, Lrmp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16970
HGNC: HGNC:6690
Homologene: 4483
Srrd
Name: SRR1 domain containing
Synonyms: Srr1, 2810002G02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70118
Homologene: 33447
Zfp692
Name: zinc finger protein 692
Synonyms: Zfp692-ps
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103836
Homologene: 9889
Ang2
Name: angiogenin, ribonuclease A family, member 2
Synonyms: Rnase5b, Angrp
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11731
VEGA: 14
HGNC: HGNC:483
Dsc2
Name: desmocollin 2
Synonyms: Dsc2b, Dsc2a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13506
HGNC: HGNC:3036
Homologene: 8397
Zfr2
Name: zinc finger RNA binding protein 2
Synonyms: 2010013I23Rik, 9130206N08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103406
Homologene: 88124
Ttll10
Name: tubulin tyrosine ligase-like family, member 10
Synonyms: 4930595O22Rik, 4833412E22Rik, Ttll5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 330010
Homologene: 51912
Anapc11
Name: anaphase promoting complex subunit 11
Synonyms: 1110011I19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66156
Homologene: 41136
Or10h1b
Name: olfactory receptor family 10 subfamily H member 1B
Synonyms: IF6, MOR267-17, GA_x6K02T2MG8L-16493-15546, MOR267-20, Olfr55
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100038859
Homologene: 110515
Tubal3
Name: tubulin, alpha-like 3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238463
VEGA: 13
Homologene: 23488
Lancl1
Name: LanC (bacterial lantibiotic synthetase component C)-like 1
Synonyms: p40, LanC-like protein 1, Gpr69a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14768
HGNC: HGNC:6508
Homologene: 4417
Sema4g
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 26456
Homologene: 22682
Klhl22
Name: kelch-like 22
Synonyms: 2610318I18Rik, Kelchl
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224023
Homologene: 23784
Rasgrf2
Name: RAS protein-specific guanine nucleotide-releasing factor 2
Synonyms: Grf2, 6330417G04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19418
HGNC: HGNC:9876
Homologene: 2169
Rab11fip5
Name: RAB11 family interacting protein 5 (class I)
Synonyms: 9130206P09Rik, RIP11, GAF1, D6Ertd32e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 52055
Homologene: 9158
Or8b41
Name: olfactory receptor family 8 subfamily B member 41
Synonyms: GA_x6K02T2PVTD-31822365-31823309, MOR162-3, MOR162-15_p, Olfr890
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258474
Homologene: 138311
Or5p6
Name: olfactory receptor family 5 subfamily P member 6
Synonyms: GA_x6K02T2PBJ9-10361879-10360935, MOR204-13, Olfr478
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258729
Homologene: 128076
Gm340
Name: predicted gene 340
Synonyms: LOC381224
Type: Gene
Species: Mouse
Chromosome: 19
Pdpr
Name: pyruvate dehydrogenase phosphatase regulatory subunit
Synonyms: 4930402E16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319518
Homologene: 9948
H2-M10.3
Name: histocompatibility 2, M region locus 10.3
Synonyms: 5.3H
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 110696
Homologene: 117973
Or10d4
Name: olfactory receptor family 10 subfamily D member 4
Synonyms: GA_x6K02T2PVTD-33365879-33366814, MOR224-13, MOR224-7P, Olfr963
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258087
VEGA: 9
Homologene: 105216
Capn15
Name: calpain 15
Synonyms: Solh
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50817
Homologene: 45782
1700019A02Rik
Name: RIKEN cDNA 1700019A02 gene
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69397
Gpr160
Name: G protein-coupled receptor 160
Synonyms: 1700025D19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71862
Homologene: 8659
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 9,880,391 bp (GRCm38)
  • T to A, chromosome 1 at 38,019,370 bp (GRCm38)
  • T to G, chromosome 1 at 38,045,479 bp (GRCm38)
  • CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT to CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT, chromosome 1 at 40,327,310 bp (GRCm38)
  • C to T, chromosome 1 at 53,182,506 bp (GRCm38)
  • G to T, chromosome 1 at 58,248,938 bp (GRCm38)
  • T to G, chromosome 1 at 67,034,222 bp (GRCm38)
  • G to A, chromosome 1 at 75,197,952 bp (GRCm38)
  • A to T, chromosome 1 at 87,147,994 bp (GRCm38)
  • T to C, chromosome 1 at 136,627,405 bp (GRCm38)
  • C to T, chromosome 1 at 173,683,395 bp (GRCm38)
  • A to T, chromosome 1 at 191,011,632 bp (GRCm38)
  • T to C, chromosome 2 at 22,241,051 bp (GRCm38)
  • T to A, chromosome 2 at 86,347,502 bp (GRCm38)
  • T to C, chromosome 2 at 89,482,412 bp (GRCm38)
  • T to C, chromosome 2 at 89,657,387 bp (GRCm38)
  • T to C, chromosome 2 at 93,762,611 bp (GRCm38)
  • T to C, chromosome 2 at 114,104,047 bp (GRCm38)
  • T to C, chromosome 2 at 164,893,475 bp (GRCm38)
  • A to G, chromosome 3 at 30,896,765 bp (GRCm38)
  • T to A, chromosome 3 at 53,653,484 bp (GRCm38)
  • T to C, chromosome 3 at 59,247,932 bp (GRCm38)
  • A to T, chromosome 4 at 43,542,893 bp (GRCm38)
  • G to A, chromosome 4 at 58,070,517 bp (GRCm38)
  • G to A, chromosome 4 at 120,463,087 bp (GRCm38)
  • A to G, chromosome 4 at 145,081,299 bp (GRCm38)
  • G to T, chromosome 4 at 156,043,159 bp (GRCm38)
  • A to G, chromosome 5 at 112,342,899 bp (GRCm38)
  • A to G, chromosome 5 at 123,709,237 bp (GRCm38)
  • A to T, chromosome 5 at 140,760,583 bp (GRCm38)
  • T to C, chromosome 5 at 142,451,634 bp (GRCm38)
  • T to C, chromosome 6 at 85,347,931 bp (GRCm38)
  • T to C, chromosome 6 at 134,920,852 bp (GRCm38)
  • A to G, chromosome 6 at 145,174,531 bp (GRCm38)
  • T to G, chromosome 7 at 3,611,664 bp (GRCm38)
  • T to C, chromosome 7 at 15,971,792 bp (GRCm38)
  • A to G, chromosome 7 at 57,508,125 bp (GRCm38)
  • A to G, chromosome 7 at 100,481,916 bp (GRCm38)
  • A to G, chromosome 7 at 102,431,050 bp (GRCm38)
  • A to T, chromosome 7 at 108,031,956 bp (GRCm38)
  • A to G, chromosome 7 at 112,077,856 bp (GRCm38)
  • T to C, chromosome 8 at 43,569,419 bp (GRCm38)
  • A to G, chromosome 8 at 111,126,293 bp (GRCm38)
  • G to A, chromosome 9 at 15,084,534 bp (GRCm38)
  • G to A, chromosome 9 at 18,484,978 bp (GRCm38)
  • G to A, chromosome 9 at 38,143,570 bp (GRCm38)
  • A to C, chromosome 9 at 39,669,315 bp (GRCm38)
  • A to T, chromosome 9 at 62,762,889 bp (GRCm38)
  • G to T, chromosome 9 at 122,775,642 bp (GRCm38)
  • T to A, chromosome 10 at 75,131,599 bp (GRCm38)
  • T to A, chromosome 10 at 81,240,135 bp (GRCm38)
  • A to G, chromosome 10 at 107,494,212 bp (GRCm38)
  • G to A, chromosome 10 at 128,397,759 bp (GRCm38)
  • C to A, chromosome 11 at 6,506,913 bp (GRCm38)
  • T to C, chromosome 11 at 29,174,697 bp (GRCm38)
  • T to G, chromosome 11 at 49,095,793 bp (GRCm38)
  • C to T, chromosome 11 at 58,308,939 bp (GRCm38)
  • T to C, chromosome 11 at 69,515,791 bp (GRCm38)
  • A to T, chromosome 11 at 75,432,668 bp (GRCm38)
  • G to A, chromosome 11 at 77,046,288 bp (GRCm38)
  • A to T, chromosome 11 at 84,814,705 bp (GRCm38)
  • A to T, chromosome 11 at 115,469,912 bp (GRCm38)
  • T to C, chromosome 11 at 120,605,424 bp (GRCm38)
  • T to A, chromosome 12 at 29,994,553 bp (GRCm38)
  • G to A, chromosome 12 at 65,106,614 bp (GRCm38)
  • T to C, chromosome 12 at 118,299,124 bp (GRCm38)
  • A to G, chromosome 13 at 3,930,674 bp (GRCm38)
  • T to C, chromosome 13 at 92,131,251 bp (GRCm38)
  • A to T, chromosome 14 at 30,123,462 bp (GRCm38)
  • C to G, chromosome 14 at 30,559,838 bp (GRCm38)
  • T to C, chromosome 14 at 30,559,839 bp (GRCm38)
  • A to G, chromosome 14 at 50,829,230 bp (GRCm38)
  • A to C, chromosome 14 at 51,195,614 bp (GRCm38)
  • G to A, chromosome 14 at 55,678,321 bp (GRCm38)
  • A to G, chromosome 14 at 70,556,437 bp (GRCm38)
  • A to G, chromosome 14 at 70,556,765 bp (GRCm38)
  • A to G, chromosome 15 at 76,453,876 bp (GRCm38)
  • T to G, chromosome 15 at 76,498,198 bp (GRCm38)
  • T to A, chromosome 16 at 17,771,799 bp (GRCm38)
  • A to G, chromosome 16 at 18,250,950 bp (GRCm38)
  • T to A, chromosome 16 at 87,729,845 bp (GRCm38)
  • T to A, chromosome 17 at 19,081,234 bp (GRCm38)
  • C to T, chromosome 17 at 25,965,379 bp (GRCm38)
  • C to A, chromosome 17 at 33,176,574 bp (GRCm38)
  • T to C, chromosome 17 at 36,366,531 bp (GRCm38)
  • A to T, chromosome 17 at 37,482,533 bp (GRCm38)
  • A to T, chromosome 18 at 20,047,219 bp (GRCm38)
  • A to G, chromosome 18 at 63,777,868 bp (GRCm38)
  • A to C, chromosome 19 at 5,497,708 bp (GRCm38)
  • C to A, chromosome 19 at 34,248,465 bp (GRCm38)
  • C to A, chromosome 19 at 41,585,246 bp (GRCm38)
  • G to A, chromosome 19 at 43,818,032 bp (GRCm38)
  • T to C, chromosome 19 at 44,992,632 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9487 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069290-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.