Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9507Btlr/Mmmh
Stock Number:
069310-MU
Citation ID:
RRID:MMRRC_069310-MU
Other Names:
R9507 (G1)
Major Collection:

Strain Information

Ide
Name: insulin degrading enzyme
Synonyms: 1300012G03Rik, 4833415K22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15925
HGNC: HGNC:5381
Homologene: 3645
Baz1b
Name: bromodomain adjacent to zinc finger domain, 1B
Synonyms: Wbscr9, WSTF
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22385
HGNC: HGNC:961
Homologene: 22651
Cep290
Name: centrosomal protein 290
Synonyms: Nphp6, b2b1454Clo, b2b1752Clo, Kiaa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216274
VEGA: 10
Homologene: 77213
Tmem104
Name: transmembrane protein 104
Synonyms: C630005D06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320534
Homologene: 9802
Arhgap35
Name: Rho GTPase activating protein 35
Synonyms: P190 RhoGAP, 6430596G11Rik, p190RhoGAP, p190A, Grlf1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232906
HGNC: HGNC:4591
Homologene: 35136
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 40,474,724 bp (GRCm38)
  • T to A, chromosome 1 at 44,206,376 bp (GRCm38)
  • T to C, chromosome 1 at 75,366,790 bp (GRCm38)
  • T to A, chromosome 1 at 174,158,986 bp (GRCm38)
  • T to A, chromosome 1 at 188,864,740 bp (GRCm38)
  • G to A, chromosome 2 at 32,595,727 bp (GRCm38)
  • T to C, chromosome 2 at 34,774,598 bp (GRCm38)
  • A to T, chromosome 2 at 67,513,936 bp (GRCm38)
  • A to G, chromosome 2 at 168,269,232 bp (GRCm38)
  • T to C, chromosome 3 at 55,665,590 bp (GRCm38)
  • T to C, chromosome 4 at 70,291,873 bp (GRCm38)
  • T to A, chromosome 4 at 93,335,008 bp (GRCm38)
  • C to A, chromosome 4 at 96,518,107 bp (GRCm38)
  • T to C, chromosome 5 at 120,127,167 bp (GRCm38)
  • C to A, chromosome 5 at 135,205,117 bp (GRCm38)
  • G to T, chromosome 6 at 42,896,901 bp (GRCm38)
  • G to A, chromosome 6 at 70,777,393 bp (GRCm38)
  • G to A, chromosome 7 at 4,957,278 bp (GRCm38)
  • A to G, chromosome 7 at 16,563,418 bp (GRCm38)
  • A to T, chromosome 7 at 28,906,972 bp (GRCm38)
  • G to A, chromosome 7 at 34,748,071 bp (GRCm38)
  • A to T, chromosome 7 at 97,304,241 bp (GRCm38)
  • GC to GCGGCGGCGCC, chromosome 7 at 97,579,934 bp (GRCm38)
  • T to G, chromosome 7 at 103,979,991 bp (GRCm38)
  • A to T, chromosome 7 at 119,580,716 bp (GRCm38)
  • CGGGGACCAGCTC to CGGGGACCAGCTCAGCCAAGGGGACCAGCTC, chromosome 7 at 126,467,588 bp (GRCm38)
  • G to A, chromosome 8 at 105,338,062 bp (GRCm38)
  • A to G, chromosome 9 at 22,362,840 bp (GRCm38)
  • A to G, chromosome 9 at 35,608,242 bp (GRCm38)
  • C to T, chromosome 9 at 108,294,509 bp (GRCm38)
  • A to C, chromosome 10 at 30,558,942 bp (GRCm38)
  • A to G, chromosome 10 at 78,879,763 bp (GRCm38)
  • C to A, chromosome 10 at 100,494,923 bp (GRCm38)
  • T to C, chromosome 11 at 58,501,750 bp (GRCm38)
  • A to G, chromosome 11 at 67,211,223 bp (GRCm38)
  • T to C, chromosome 11 at 87,059,438 bp (GRCm38)
  • T to A, chromosome 11 at 104,187,327 bp (GRCm38)
  • T to C, chromosome 11 at 115,200,873 bp (GRCm38)
  • A to C, chromosome 12 at 40,217,226 bp (GRCm38)
  • A to G, chromosome 12 at 45,019,577 bp (GRCm38)
  • A to T, chromosome 13 at 50,467,419 bp (GRCm38)
  • A to G, chromosome 13 at 106,957,148 bp (GRCm38)
  • A to T, chromosome 14 at 52,349,221 bp (GRCm38)
  • A to G, chromosome 14 at 69,777,772 bp (GRCm38)
  • A to G, chromosome 15 at 58,898,815 bp (GRCm38)
  • A to G, chromosome 15 at 76,519,092 bp (GRCm38)
  • T to C, chromosome 16 at 30,274,011 bp (GRCm38)
  • T to C, chromosome 16 at 43,943,829 bp (GRCm38)
  • C to T, chromosome 17 at 22,145,601 bp (GRCm38)
  • G to A, chromosome 17 at 27,118,677 bp (GRCm38)
  • T to A, chromosome 18 at 49,891,500 bp (GRCm38)
  • A to G, chromosome 19 at 4,614,329 bp (GRCm38)
  • A to G, chromosome 19 at 8,889,223 bp (GRCm38)
  • A to T, chromosome 19 at 37,288,137 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9507 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069310-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.