Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9514Btlr/Mmmh
Stock Number:
069316-MU
Citation ID:
RRID:MMRRC_069316-MU
Other Names:
R9514 (G1)
Major Collection:

Strain Information

Figla
Name: folliculogenesis specific basic helix-loop-helix
Synonyms: FIG alpha, bHLHc8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 26910
Homologene: 49294
Ptch1
Name: patched 1
Synonyms: Ptc, Patched 1, Ptc1, A230106A15Rik, wig
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19206
HGNC: HGNC:9585
Homologene: 223
Galr2
Name: galanin receptor 2
Synonyms: mGalR, GalR2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14428
HGNC: HGNC:4133
Homologene: 2863
Plin3
Name: perilipin 3
Synonyms: 1300012C15Rik, Tip47, M6prbp1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66905
VEGA: 17
Homologene: 4247
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Gart
Name: phosphoribosylglycinamide formyltransferase
Synonyms: Gaps, Prgs
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14450
HGNC: HGNC:4163
Homologene: 637
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 43,978,488 bp (GRCm38)
  • C to T, chromosome 1 at 74,906,309 bp (GRCm38)
  • T to A, chromosome 1 at 156,030,431 bp (GRCm38)
  • A to G, chromosome 1 at 165,138,977 bp (GRCm38)
  • T to C, chromosome 1 at 171,284,930 bp (GRCm38)
  • A to G, chromosome 2 at 18,159,511 bp (GRCm38)
  • A to G, chromosome 2 at 73,312,437 bp (GRCm38)
  • G to A, chromosome 2 at 90,266,365 bp (GRCm38)
  • A to T, chromosome 2 at 91,648,023 bp (GRCm38)
  • C to G, chromosome 2 at 120,704,083 bp (GRCm38)
  • T to C, chromosome 2 at 128,931,303 bp (GRCm38)
  • G to T, chromosome 2 at 150,238,970 bp (GRCm38)
  • A to G, chromosome 2 at 155,406,213 bp (GRCm38)
  • C to T, chromosome 2 at 166,577,976 bp (GRCm38)
  • A to G, chromosome 2 at 180,593,624 bp (GRCm38)
  • T to A, chromosome 3 at 10,335,472 bp (GRCm38)
  • G to C, chromosome 3 at 27,372,481 bp (GRCm38)
  • A to T, chromosome 3 at 56,029,945 bp (GRCm38)
  • A to G, chromosome 3 at 96,220,085 bp (GRCm38)
  • T to C, chromosome 3 at 103,331,758 bp (GRCm38)
  • A to G, chromosome 3 at 108,911,303 bp (GRCm38)
  • A to T, chromosome 4 at 130,338,544 bp (GRCm38)
  • A to G, chromosome 5 at 33,657,778 bp (GRCm38)
  • T to C, chromosome 5 at 73,104,772 bp (GRCm38)
  • A to T, chromosome 5 at 73,672,497 bp (GRCm38)
  • T to C, chromosome 6 at 83,032,991 bp (GRCm38)
  • A to C, chromosome 6 at 86,020,707 bp (GRCm38)
  • T to C, chromosome 6 at 113,472,780 bp (GRCm38)
  • T to C, chromosome 6 at 113,492,804 bp (GRCm38)
  • T to C, chromosome 6 at 119,236,650 bp (GRCm38)
  • A to G, chromosome 6 at 123,712,713 bp (GRCm38)
  • C to T, chromosome 6 at 146,623,681 bp (GRCm38)
  • CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC to CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC, chromosome 7 at 29,247,623 bp (GRCm38)
  • A to T, chromosome 7 at 43,532,726 bp (GRCm38)
  • AGCTCAGCCACGGGGACC to AGCTCAGCCACGGGGACCCGCTCAGCCACGGGGACC, chromosome 7 at 126,467,578 bp (GRCm38)
  • ACCAGCTC to ACCAGCTCAGCCACGGGGGCCAGCTC, chromosome 7 at 126,467,593 bp (GRCm38)
  • CTC to CTCCGCCACGGGGACCAGTTC, chromosome 7 at 126,467,598 bp (GRCm38)
  • T to C, chromosome 8 at 13,885,081 bp (GRCm38)
  • C to G, chromosome 8 at 66,513,188 bp (GRCm38)
  • T to C, chromosome 8 at 70,027,503 bp (GRCm38)
  • A to C, chromosome 8 at 80,702,211 bp (GRCm38)
  • T to C, chromosome 8 at 109,669,217 bp (GRCm38)
  • C to T, chromosome 9 at 108,480,807 bp (GRCm38)
  • T to A, chromosome 10 at 14,129,779 bp (GRCm38)
  • T to C, chromosome 10 at 27,224,019 bp (GRCm38)
  • T to C, chromosome 10 at 79,541,662 bp (GRCm38)
  • T to A, chromosome 11 at 46,162,095 bp (GRCm38)
  • A to G, chromosome 11 at 54,335,054 bp (GRCm38)
  • T to C, chromosome 11 at 54,552,858 bp (GRCm38)
  • T to A, chromosome 11 at 55,284,982 bp (GRCm38)
  • T to C, chromosome 11 at 58,421,707 bp (GRCm38)
  • G to T, chromosome 11 at 58,987,651 bp (GRCm38)
  • T to C, chromosome 11 at 60,262,660 bp (GRCm38)
  • T to C, chromosome 11 at 85,022,734 bp (GRCm38)
  • A to T, chromosome 11 at 100,038,400 bp (GRCm38)
  • A to G, chromosome 11 at 116,283,626 bp (GRCm38)
  • T to C, chromosome 13 at 14,055,157 bp (GRCm38)
  • A to T, chromosome 13 at 22,354,845 bp (GRCm38)
  • T to A, chromosome 13 at 38,187,805 bp (GRCm38)
  • A to G, chromosome 13 at 45,567,957 bp (GRCm38)
  • A to G, chromosome 13 at 59,742,992 bp (GRCm38)
  • T to C, chromosome 13 at 63,527,257 bp (GRCm38)
  • T to G, chromosome 13 at 104,234,174 bp (GRCm38)
  • T to C, chromosome 13 at 106,957,128 bp (GRCm38)
  • A to G, chromosome 14 at 70,077,529 bp (GRCm38)
  • T to A, chromosome 14 at 103,695,312 bp (GRCm38)
  • G to A, chromosome 15 at 57,986,369 bp (GRCm38)
  • C to T, chromosome 15 at 78,993,178 bp (GRCm38)
  • A to G, chromosome 15 at 99,946,885 bp (GRCm38)
  • G to A, chromosome 15 at 101,931,853 bp (GRCm38)
  • T to C, chromosome 16 at 17,258,429 bp (GRCm38)
  • T to A, chromosome 16 at 55,905,730 bp (GRCm38)
  • A to T, chromosome 16 at 91,630,708 bp (GRCm38)
  • A to G, chromosome 17 at 27,893,440 bp (GRCm38)
  • G to T, chromosome 17 at 37,280,495 bp (GRCm38)
  • T to A, chromosome 17 at 46,576,818 bp (GRCm38)
  • C to A, chromosome 17 at 56,280,824 bp (GRCm38)
  • A to G, chromosome 17 at 66,809,471 bp (GRCm38)
  • G to C, chromosome 17 at 74,446,741 bp (GRCm38)
  • A to T, chromosome 17 at 78,932,255 bp (GRCm38)
  • G to T, chromosome 18 at 37,022,473 bp (GRCm38)
  • A to G, chromosome 19 at 22,982,676 bp (GRCm38)
  • T to C, chromosome 19 at 26,682,052 bp (GRCm38)
  • A to T, chromosome 19 at 36,605,289 bp (GRCm38)
  • G to A, chromosome 19 at 42,518,764 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9514 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069316-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.