Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9642Btlr/Mmmh
Stock Number:
069435-MU
Citation ID:
RRID:MMRRC_069435-MU
Other Names:
R9642 (G1)
Major Collection:

Strain Information

Prkaca
Name: protein kinase, cAMP dependent, catalytic, alpha
Synonyms: Cs, C alpha, PKA, Pkaca
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18747
HGNC: HGNC:9380
Homologene: 121574
Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Uso1
Name: USO1 vesicle docking factor
Synonyms: transcytosis associated protein p115, TAP, Vdp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56041
Homologene: 2754
Hmox1
Name: heme oxygenase 1
Synonyms: Hsp32, HO-1, heme oxygenase 1, D8Wsu38e, Hmox, HO1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15368
HGNC: HGNC:5013
Homologene: 31075
Ncam2
Name: neural cell adhesion molecule 2
Synonyms: RNCAM, R4B12 antigen, Ncam-2, Ocam
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17968
HGNC: HGNC:7657
Homologene: 3336
Upp1
Name: uridine phosphorylase 1
Synonyms: UdRPase, UPase, Up
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22271
Homologene: 2524
Tpst1
Name: protein-tyrosine sulfotransferase 1
Synonyms: Tango13a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22021
Homologene: 2667
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 75,534,255 bp (GRCm38)
  • A to G, chromosome 1 at 139,810,882 bp (GRCm38)
  • A to T, chromosome 1 at 173,972,284 bp (GRCm38)
  • T to C, chromosome 1 at 180,948,828 bp (GRCm38)
  • T to G, chromosome 1 at 185,235,495 bp (GRCm38)
  • T to C, chromosome 2 at 72,441,837 bp (GRCm38)
  • A to G, chromosome 2 at 76,974,226 bp (GRCm38)
  • A to T, chromosome 2 at 89,325,563 bp (GRCm38)
  • T to C, chromosome 2 at 94,364,390 bp (GRCm38)
  • A to T, chromosome 2 at 125,840,490 bp (GRCm38)
  • T to C, chromosome 2 at 155,831,060 bp (GRCm38)
  • C to A, chromosome 4 at 83,681,288 bp (GRCm38)
  • T to C, chromosome 4 at 108,259,988 bp (GRCm38)
  • A to G, chromosome 4 at 116,313,769 bp (GRCm38)
  • A to T, chromosome 4 at 132,699,063 bp (GRCm38)
  • A to G, chromosome 4 at 132,785,736 bp (GRCm38)
  • A to G, chromosome 4 at 135,121,030 bp (GRCm38)
  • A to G, chromosome 4 at 144,455,942 bp (GRCm38)
  • A to T, chromosome 5 at 57,719,375 bp (GRCm38)
  • T to A, chromosome 5 at 92,138,108 bp (GRCm38)
  • T to C, chromosome 5 at 100,040,256 bp (GRCm38)
  • A to G, chromosome 5 at 110,342,012 bp (GRCm38)
  • T to A, chromosome 5 at 130,102,118 bp (GRCm38)
  • A to C, chromosome 6 at 47,544,519 bp (GRCm38)
  • T to A, chromosome 6 at 57,071,231 bp (GRCm38)
  • G to A, chromosome 6 at 88,004,205 bp (GRCm38)
  • A to G, chromosome 6 at 116,551,389 bp (GRCm38)
  • A to T, chromosome 6 at 126,916,290 bp (GRCm38)
  • A to T, chromosome 6 at 132,777,499 bp (GRCm38)
  • T to A, chromosome 7 at 27,964,710 bp (GRCm38)
  • A to T, chromosome 7 at 30,583,915 bp (GRCm38)
  • C to A, chromosome 7 at 45,990,341 bp (GRCm38)
  • C to A, chromosome 7 at 118,838,228 bp (GRCm38)
  • C to A, chromosome 7 at 131,246,528 bp (GRCm38)
  • A to T, chromosome 7 at 141,795,864 bp (GRCm38)
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp (GRCm38)
  • G to A, chromosome 8 at 75,097,253 bp (GRCm38)
  • A to G, chromosome 8 at 83,990,459 bp (GRCm38)
  • T to A, chromosome 9 at 23,483,902 bp (GRCm38)
  • T to C, chromosome 9 at 39,394,561 bp (GRCm38)
  • T to C, chromosome 9 at 45,088,818 bp (GRCm38)
  • A to G, chromosome 9 at 56,259,921 bp (GRCm38)
  • A to C, chromosome 9 at 67,250,544 bp (GRCm38)
  • T to A, chromosome 9 at 95,939,241 bp (GRCm38)
  • A to G, chromosome 9 at 107,515,428 bp (GRCm38)
  • T to C, chromosome 10 at 58,483,085 bp (GRCm38)
  • C to T, chromosome 10 at 78,879,561 bp (GRCm38)
  • T to C, chromosome 11 at 5,955,917 bp (GRCm38)
  • A to G, chromosome 11 at 9,135,206 bp (GRCm38)
  • T to A, chromosome 11 at 58,346,259 bp (GRCm38)
  • A to G, chromosome 11 at 115,881,509 bp (GRCm38)
  • T to C, chromosome 11 at 120,660,154 bp (GRCm38)
  • A to T, chromosome 12 at 115,848,298 bp (GRCm38)
  • T to A, chromosome 13 at 14,340,809 bp (GRCm38)
  • A to T, chromosome 14 at 54,625,838 bp (GRCm38)
  • T to C, chromosome 14 at 55,659,476 bp (GRCm38)
  • A to T, chromosome 15 at 3,325,987 bp (GRCm38)
  • T to C, chromosome 15 at 77,423,903 bp (GRCm38)
  • T to A, chromosome 15 at 85,867,496 bp (GRCm38)
  • T to C, chromosome 15 at 101,487,193 bp (GRCm38)
  • C to A, chromosome 16 at 5,097,738 bp (GRCm38)
  • A to G, chromosome 16 at 17,148,209 bp (GRCm38)
  • C to A, chromosome 16 at 25,863,758 bp (GRCm38)
  • T to A, chromosome 16 at 36,716,128 bp (GRCm38)
  • A to T, chromosome 16 at 59,315,247 bp (GRCm38)
  • A to T, chromosome 16 at 81,621,363 bp (GRCm38)
  • A to G, chromosome 16 at 97,455,176 bp (GRCm38)
  • T to C, chromosome 17 at 20,360,399 bp (GRCm38)
  • A to G, chromosome 17 at 25,853,720 bp (GRCm38)
  • T to C, chromosome 18 at 6,619,412 bp (GRCm38)
  • C to T, chromosome 18 at 24,004,098 bp (GRCm38)
  • G to A, chromosome 18 at 49,880,758 bp (GRCm38)
  • A to G, chromosome 18 at 82,604,259 bp (GRCm38)
  • C to T, chromosome 19 at 6,250,168 bp (GRCm38)
  • A to G, chromosome 19 at 23,261,388 bp (GRCm38)
  • A to T, chromosome 19 at 46,270,268 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9642 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069435-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.