Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9642Btlr/Mmmh
Stock Number:
069435-MU
Citation ID:
RRID:MMRRC_069435-MU
Other Names:
R9642 (G1)
Major Collection:

Strain Information

Prkaca
Name: protein kinase, cAMP dependent, catalytic, alpha
Synonyms: Cs, C alpha, PKA, Pkaca
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18747
HGNC: HGNC:9380
Homologene: 121574
Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Uso1
Name: USO1 vesicle docking factor
Synonyms: transcytosis associated protein p115, TAP, Vdp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56041
Homologene: 2754
Hmox1
Name: heme oxygenase 1
Synonyms: Hsp32, HO-1, heme oxygenase 1, D8Wsu38e, Hmox, HO1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15368
HGNC: HGNC:5013
Homologene: 31075
Ncam2
Name: neural cell adhesion molecule 2
Synonyms: RNCAM, R4B12 antigen, Ncam-2, Ocam
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17968
HGNC: HGNC:7657
Homologene: 3336
Upp1
Name: uridine phosphorylase 1
Synonyms: UdRPase, UPase, Up
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22271
Homologene: 2524
Tpst1
Name: protein-tyrosine sulfotransferase 1
Synonyms: Tango13a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22021
Homologene: 2667
Mast2
Name: microtubule associated serine/threonine kinase 2
Synonyms: MAST205, Mtssk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17776
Homologene: 7428
Stk11ip
Name: serine/threonine kinase 11 interacting protein
Synonyms: LKB1IP, LIP1, 1200014D22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71728
Homologene: 12406
Vps35l
Name: VPS35 endosomal protein sorting factor like
Synonyms: 9030624J02Rik, Vsp35l
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71517
Homologene: 10659
Ezh2
Name: enhancer of zeste 2 polycomb repressive complex 2 subunit
Synonyms: Enx-1, Enx1h, KMT6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14056
HGNC: HGNC:3527
Homologene: 37926
Cops2
Name: COP9 signalosome subunit 2
Synonyms: Sgn2, Trip15, alien-like, alien homologue, Csn2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12848
Homologene: 3124
Gtse1
Name: G two S phase expressed protein 1
Synonyms: B99, Gtse-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 29870
VEGA: 15
Homologene: 8489
Rab3gap2
Name: RAB3 GTPase activating protein subunit 2
Synonyms: 1110059F07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98732
Homologene: 40842
Ttc17
Name: tetratricopeptide repeat domain 17
Synonyms: D2Bwg1005e, 9130020K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74569
Homologene: 10100
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Ranbp2
Name: RAN binding protein 2
Synonyms: A430087B05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19386
VEGA: 10
HGNC: HGNC:9848
Homologene: 87808
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Gbf1
Name: golgi-specific brefeldin A-resistance factor 1
Synonyms: 1700083E03Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107338
HGNC: HGNC:4181
Homologene: 37897
Map3k20
Name: mitogen-activated protein kinase kinase kinase 20
Synonyms: MLTKbeta, MLTKalpha, B230120H23Rik, Zak
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65964
Homologene: 32331
Zfp35
Name: zinc finger protein 35
Synonyms: Zfp-35
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 22694
Homologene: 133081
Smc5
Name: structural maintenance of chromosomes 5
Synonyms: Smc5l1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226026
VEGA: 19
Homologene: 41009
Eya3
Name: EYA transcriptional coactivator and phosphatase 3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14050
HGNC: HGNC:3521
Homologene: 1508
Rab7
Name: RAB7, member RAS oncogene family
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19349
HGNC: HGNC:9788
Homologene: 3408
Jaml
Name: junction adhesion molecule like
Synonyms: LOC270152, Amica1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270152
Homologene: 17708
Enoph1
Name: enolase-phosphatase 1
Synonyms: 2310057D15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67870
Homologene: 5790
Ccdc171
Name: coiled-coil domain containing 171
Synonyms: 4930418J05Rik, A330015D16Rik, 4930473A06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320226
Homologene: 27942
Zfp236
Name: zinc finger protein 236
Synonyms: LOC240456
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 329002
Homologene: 7198
Sh3bp5l
Name: SH3 binding domain protein 5 like
Synonyms: 2310074E09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 79566
Homologene: 32584
Peak1
Name: pseudopodium-enriched atypical kinase 1
Synonyms: 1110049L02Rik, NKF3 kinase family member, C230081A13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244895
Homologene: 18259
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Bmper
Name: BMP-binding endothelial regulator
Synonyms: Cv2, 3110056H04Rik, CV-2, Crim3, crossveinless-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73230
VEGA: 9
Homologene: 12494
Ghr
Name: growth hormone receptor
Synonyms: GHBP, GHR/BP
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14600
HGNC: HGNC:4263
Homologene: 134
Cacna2d2
Name: calcium channel, voltage-dependent, alpha 2/delta subunit 2
Synonyms: a2d2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56808
HGNC: HGNC:1400
Homologene: 4400
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pcdh7
Name: protocadherin 7
Synonyms: BH-protocadherin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54216
HGNC: HGNC:8659
Homologene: 36101
Mx1
Name: MX dynamin-like GTPase 1
Synonyms: myxovirus (influenza) resistance 1 polypeptide, Mx-1, Mx
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17857
Cdcp3
Name: CUB domain containing protein 3
Synonyms: 5430419D17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71395
Homologene: 138430
Tmem63a
Name: transmembrane protein 63a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208795
Homologene: 101673
Kmt2b
Name: lysine (K)-specific methyltransferase 2B
Synonyms: 2610014H22Rik, Mll2, Wbp7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75410
Homologene: 22838
Abcc6
Name: ATP-binding cassette, sub-family C member 6
Synonyms: DCC, Mrp6, Dyscalc1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27421
HGNC: HGNC:57
Homologene: 55559
Trp63
Name: transformation related protein 63
Synonyms: KET protein, p63, p73L, Trp53rp1, TAp63, p51/p63, deltaNp63
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22061
Homologene: 31189
Myo15b
Name: myosin XVB
Synonyms: LOC217328, LOC380737, E330039G21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217328
Atg2a
Name: autophagy related 2A
Synonyms: 1810013C15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 329015
Homologene: 86985
Themis2
Name: thymocyte selection associated family member 2
Synonyms: ICB-1, BC013712
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230787
Homologene: 21009
Wdr90
Name: WD repeat domain 90
Synonyms: 3230401M21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106618
Homologene: 27066
Or8g32
Name: olfactory receptor family 8 subfamily G member 32
Synonyms: GA_x6K02T2PVTD-33090395-33091330, MOR171-33P, MOR171-49, Olfr951
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258046
VEGA: 9
HGNC: HGNC:8484
Homologene: 71961
Ildr1
Name: immunoglobulin-like domain containing receptor 1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106347
Homologene: 15892
Fam83c
Name: family with sequence similarity 83, member C
Synonyms: 5530400B04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71405
Homologene: 18669
Notum
Name: notum palmitoleoyl-protein carboxylesterase
Synonyms: 5730593N15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77583
Homologene: 45335
Or5ac22
Name: olfactory receptor family 5 subfamily AC member 22
Synonyms: GA_x54KRFPKG5P-55529713-55528796, MOR182-3, Olfr204
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258994
Homologene: 79425
Ifi202b
Name: interferon activated gene 202B
Synonyms: p202
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26388
Vmn2r107
Name: vomeronasal 2, receptor 107
Synonyms: V2r6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22312
Homologene: 129750
Zyg11b
Name: zyg-ll family member B, cell cycle regulator
Synonyms: LOC242610, 1110046I03Rik, D4Mgi23, 2810482G21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 414872
Homologene: 14600
Krt83
Name: keratin 83
Synonyms: 5430421N21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 100126226
HGNC: HGNC:6460
Homologene: 68248
Mdp1
Name: magnesium-dependent phosphatase 1
Synonyms: 1810034K20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67881
VEGA: 14
Homologene: 5846
P2rx2
Name: purinergic receptor P2X, ligand-gated ion channel, 2
Synonyms: P2X2a, P2x2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231602
Homologene: 14251
Zfp780b
Name: zinc finger protein 780B
Synonyms: B230208L21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 338354
Homologene: 85969
Cfhr2
Name: complement factor H-related 2
Synonyms: FHR-B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545366
Homologene: 134349
Aadacl3
Name: arylacetamide deacetylase like 3
Synonyms: LOC230883
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230883
Homologene: 28426
4921524L21Rik
Name: RIKEN cDNA 4921524L21 gene
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70901
VEGA: 18
Homologene: 78009
Vmn1r9
Name: vomeronasal 1 receptor 9
Synonyms: V1rc30
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171203
Homologene: 76459
Hecw1
Name: HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
Synonyms: NEDL1, E130207I19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 94253
VEGA: 13
Homologene: 9004
Dyrk4
Name: dual-specificity tyrosine phosphorylation regulated kinase 4
Synonyms: Dyrk4b, Dyrk4a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101320
HGNC: HGNC:3095
Homologene: 37858
Ykt6
Name: YKT6 v-SNARE homolog (S. cerevisiae)
Synonyms: 1810013M05Rik, 0610042I15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56418
Homologene: 4778
Ppl
Name: periplakin
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19041
VEGA: 16
HGNC: HGNC:9273
Homologene: 2026
Or4c124
Name: olfactory receptor family 4 subfamily C member 124
Synonyms: GA_x6K02T2Q125-50770831-50769896, MOR233-18, Olfr1232
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258320
Homologene: 74068
Or7a39
Name: olfactory receptor family 7 subfamily A member 39
Synonyms: GA_x6K02T2QGN0-2932609-2931677, MOR139-6, Olfr1355
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 257734
Homologene: 136441
Ydjc
Name: YdjC homolog (bacterial)
Synonyms: 4930521M19Rik, 1810015A11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 69101
Homologene: 19062
Runx3
Name: runt related transcription factor 3
Synonyms: AML2, Cbfa3, Rx3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12399
Homologene: 37914
Psmb11
Name: proteasome (prosome, macropain) subunit, beta type, 11
Synonyms: beta5t, 5830406J20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 73902
VEGA: 14
Homologene: 13729
Ighv1-76
Name: immunoglobulin heavy variable 1-76
Synonyms: Gm16813
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100775174
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Eif4a3l2
Name: eukaryotic translation initiation factor 4A3 like 2
Synonyms: Gm5580
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 434080
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 75,534,255 bp (GRCm38)
  • A to G, chromosome 1 at 139,810,882 bp (GRCm38)
  • A to T, chromosome 1 at 173,972,284 bp (GRCm38)
  • T to C, chromosome 1 at 180,948,828 bp (GRCm38)
  • T to G, chromosome 1 at 185,235,495 bp (GRCm38)
  • T to C, chromosome 2 at 72,441,837 bp (GRCm38)
  • A to G, chromosome 2 at 76,974,226 bp (GRCm38)
  • A to T, chromosome 2 at 89,325,563 bp (GRCm38)
  • T to C, chromosome 2 at 94,364,390 bp (GRCm38)
  • A to T, chromosome 2 at 125,840,490 bp (GRCm38)
  • T to C, chromosome 2 at 155,831,060 bp (GRCm38)
  • C to A, chromosome 4 at 83,681,288 bp (GRCm38)
  • T to C, chromosome 4 at 108,259,988 bp (GRCm38)
  • A to G, chromosome 4 at 116,313,769 bp (GRCm38)
  • A to T, chromosome 4 at 132,699,063 bp (GRCm38)
  • A to G, chromosome 4 at 132,785,736 bp (GRCm38)
  • A to G, chromosome 4 at 135,121,030 bp (GRCm38)
  • A to G, chromosome 4 at 144,455,942 bp (GRCm38)
  • A to T, chromosome 5 at 57,719,375 bp (GRCm38)
  • T to A, chromosome 5 at 92,138,108 bp (GRCm38)
  • T to C, chromosome 5 at 100,040,256 bp (GRCm38)
  • A to G, chromosome 5 at 110,342,012 bp (GRCm38)
  • T to A, chromosome 5 at 130,102,118 bp (GRCm38)
  • A to C, chromosome 6 at 47,544,519 bp (GRCm38)
  • T to A, chromosome 6 at 57,071,231 bp (GRCm38)
  • G to A, chromosome 6 at 88,004,205 bp (GRCm38)
  • A to G, chromosome 6 at 116,551,389 bp (GRCm38)
  • A to T, chromosome 6 at 126,916,290 bp (GRCm38)
  • A to T, chromosome 6 at 132,777,499 bp (GRCm38)
  • T to A, chromosome 7 at 27,964,710 bp (GRCm38)
  • A to T, chromosome 7 at 30,583,915 bp (GRCm38)
  • C to A, chromosome 7 at 45,990,341 bp (GRCm38)
  • C to A, chromosome 7 at 118,838,228 bp (GRCm38)
  • C to A, chromosome 7 at 131,246,528 bp (GRCm38)
  • A to T, chromosome 7 at 141,795,864 bp (GRCm38)
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp (GRCm38)
  • G to A, chromosome 8 at 75,097,253 bp (GRCm38)
  • A to G, chromosome 8 at 83,990,459 bp (GRCm38)
  • T to A, chromosome 9 at 23,483,902 bp (GRCm38)
  • T to C, chromosome 9 at 39,394,561 bp (GRCm38)
  • T to C, chromosome 9 at 45,088,818 bp (GRCm38)
  • A to G, chromosome 9 at 56,259,921 bp (GRCm38)
  • A to C, chromosome 9 at 67,250,544 bp (GRCm38)
  • T to A, chromosome 9 at 95,939,241 bp (GRCm38)
  • A to G, chromosome 9 at 107,515,428 bp (GRCm38)
  • T to C, chromosome 10 at 58,483,085 bp (GRCm38)
  • C to T, chromosome 10 at 78,879,561 bp (GRCm38)
  • T to C, chromosome 11 at 5,955,917 bp (GRCm38)
  • A to G, chromosome 11 at 9,135,206 bp (GRCm38)
  • T to A, chromosome 11 at 58,346,259 bp (GRCm38)
  • A to G, chromosome 11 at 115,881,509 bp (GRCm38)
  • T to C, chromosome 11 at 120,660,154 bp (GRCm38)
  • A to T, chromosome 12 at 115,848,298 bp (GRCm38)
  • T to A, chromosome 13 at 14,340,809 bp (GRCm38)
  • A to T, chromosome 14 at 54,625,838 bp (GRCm38)
  • T to C, chromosome 14 at 55,659,476 bp (GRCm38)
  • A to T, chromosome 15 at 3,325,987 bp (GRCm38)
  • T to C, chromosome 15 at 77,423,903 bp (GRCm38)
  • T to A, chromosome 15 at 85,867,496 bp (GRCm38)
  • T to C, chromosome 15 at 101,487,193 bp (GRCm38)
  • C to A, chromosome 16 at 5,097,738 bp (GRCm38)
  • A to G, chromosome 16 at 17,148,209 bp (GRCm38)
  • C to A, chromosome 16 at 25,863,758 bp (GRCm38)
  • T to A, chromosome 16 at 36,716,128 bp (GRCm38)
  • A to T, chromosome 16 at 59,315,247 bp (GRCm38)
  • A to T, chromosome 16 at 81,621,363 bp (GRCm38)
  • A to G, chromosome 16 at 97,455,176 bp (GRCm38)
  • T to C, chromosome 17 at 20,360,399 bp (GRCm38)
  • A to G, chromosome 17 at 25,853,720 bp (GRCm38)
  • T to C, chromosome 18 at 6,619,412 bp (GRCm38)
  • C to T, chromosome 18 at 24,004,098 bp (GRCm38)
  • G to A, chromosome 18 at 49,880,758 bp (GRCm38)
  • A to G, chromosome 18 at 82,604,259 bp (GRCm38)
  • C to T, chromosome 19 at 6,250,168 bp (GRCm38)
  • A to G, chromosome 19 at 23,261,388 bp (GRCm38)
  • A to T, chromosome 19 at 46,270,268 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9642 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069435-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.