Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9646Btlr/Mmmh
Stock Number:
069439-MU
Citation ID:
RRID:MMRRC_069439-MU
Other Names:
R9646 (G1)
Major Collection:

Strain Information

Nrp2
Name: neuropilin 2
Synonyms: NP2, Npn-2, Npn2, NP-2, 1110048P06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18187
HGNC: HGNC:8005
Homologene: 2875
Tnrc6b
Name: trinucleotide repeat containing 6b
Synonyms: A730065C02Rik, D230019K20Rik, 2700090M07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 213988
VEGA: 15
Homologene: 66194
Slc6a5
Name: solute carrier family 6 (neurotransmitter transporter, glycine), member 5
Synonyms: Glyt2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 104245
Homologene: 37901
Septin3
Name: septin 3
Synonyms: Sep3, B530002E20Rik, 3110018K01Rik, Gm46500, Sept3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 24050
VEGA: 15
Homologene: 99740
Sez6
Name: seizure related gene 6
Synonyms: sez-6, D11Bhm177e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20370
Homologene: 10948
Pepd
Name: peptidase D
Synonyms: Pep-4, peptidase D, Pep4, dal
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18624
HGNC: HGNC:8840
Homologene: 239
Scrib
Name: scribbled planar cell polarity
Synonyms: Scrb1, Crc
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105782
Homologene: 44228
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 40,123,202 bp (GRCm38)
  • T to C, chromosome 1 at 62,738,407 bp (GRCm38)
  • T to A, chromosome 1 at 85,100,180 bp (GRCm38)
  • A to T, chromosome 1 at 87,192,589 bp (GRCm38)
  • A to C, chromosome 1 at 121,312,311 bp (GRCm38)
  • A to G, chromosome 1 at 163,994,626 bp (GRCm38)
  • T to A, chromosome 2 at 20,797,913 bp (GRCm38)
  • T to A, chromosome 2 at 85,976,102 bp (GRCm38)
  • T to A, chromosome 2 at 87,738,168 bp (GRCm38)
  • TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT to TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT, chromosome 2 at 121,397,572 bp (GRCm38)
  • T to A, chromosome 2 at 146,012,232 bp (GRCm38)
  • C to T, chromosome 2 at 150,268,184 bp (GRCm38)
  • A to G, chromosome 3 at 38,981,664 bp (GRCm38)
  • A to T, chromosome 3 at 87,814,498 bp (GRCm38)
  • T to A, chromosome 3 at 115,915,043 bp (GRCm38)
  • A to T, chromosome 3 at 148,839,290 bp (GRCm38)
  • C to A, chromosome 4 at 43,017,967 bp (GRCm38)
  • T to C, chromosome 4 at 47,120,390 bp (GRCm38)
  • T to A, chromosome 4 at 47,257,187 bp (GRCm38)
  • T to A, chromosome 4 at 109,794,819 bp (GRCm38)
  • T to A, chromosome 4 at 138,592,109 bp (GRCm38)
  • A to T, chromosome 4 at 143,897,064 bp (GRCm38)
  • C to T, chromosome 4 at 147,931,655 bp (GRCm38)
  • C to T, chromosome 5 at 35,392,056 bp (GRCm38)
  • T to C, chromosome 5 at 53,706,266 bp (GRCm38)
  • T to A, chromosome 5 at 69,521,081 bp (GRCm38)
  • T to C, chromosome 5 at 103,977,107 bp (GRCm38)
  • T to C, chromosome 5 at 123,759,056 bp (GRCm38)
  • T to A, chromosome 5 at 139,166,077 bp (GRCm38)
  • GC to GCTCC, chromosome 6 at 4,756,452 bp (GRCm38)
  • T to A, chromosome 6 at 85,289,213 bp (GRCm38)
  • A to T, chromosome 6 at 86,753,832 bp (GRCm38)
  • A to G, chromosome 6 at 108,394,884 bp (GRCm38)
  • T to C, chromosome 7 at 4,241,908 bp (GRCm38)
  • T to C, chromosome 7 at 21,272,336 bp (GRCm38)
  • A to T, chromosome 7 at 34,921,457 bp (GRCm38)
  • A to T, chromosome 7 at 49,917,748 bp (GRCm38)
  • G to A, chromosome 7 at 76,425,900 bp (GRCm38)
  • A to T, chromosome 7 at 92,624,049 bp (GRCm38)
  • T to C, chromosome 7 at 105,057,167 bp (GRCm38)
  • C to T, chromosome 7 at 141,690,400 bp (GRCm38)
  • T to A, chromosome 9 at 38,308,818 bp (GRCm38)
  • C to T, chromosome 9 at 54,946,237 bp (GRCm38)
  • A to G, chromosome 9 at 88,584,339 bp (GRCm38)
  • A to G, chromosome 10 at 5,229,187 bp (GRCm38)
  • T to C, chromosome 10 at 39,822,444 bp (GRCm38)
  • T to C, chromosome 11 at 3,220,280 bp (GRCm38)
  • A to G, chromosome 11 at 77,976,806 bp (GRCm38)
  • A to T, chromosome 11 at 102,255,760 bp (GRCm38)
  • T to A, chromosome 12 at 34,437,168 bp (GRCm38)
  • T to C, chromosome 14 at 70,590,368 bp (GRCm38)
  • C to T, chromosome 15 at 76,060,643 bp (GRCm38)
  • T to C, chromosome 15 at 79,003,734 bp (GRCm38)
  • T to A, chromosome 15 at 80,889,065 bp (GRCm38)
  • T to C, chromosome 15 at 82,285,887 bp (GRCm38)
  • T to C, chromosome 15 at 99,695,533 bp (GRCm38)
  • A to T, chromosome 17 at 23,919,182 bp (GRCm38)
  • A to T, chromosome 17 at 25,567,897 bp (GRCm38)
  • A to T, chromosome 17 at 36,120,265 bp (GRCm38)
  • A to G, chromosome 17 at 52,797,545 bp (GRCm38)
  • A to T, chromosome 18 at 37,485,418 bp (GRCm38)
  • T to A, chromosome 18 at 61,078,649 bp (GRCm38)
  • G to A, chromosome 19 at 4,103,269 bp (GRCm38)
  • G to T, chromosome 19 at 4,745,313 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9646 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069439-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.