Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9646Btlr/Mmmh
Stock Number:
069439-MU
Citation ID:
RRID:MMRRC_069439-MU
Other Names:
R9646 (G1)
Major Collection:

Strain Information

Nrp2
Name: neuropilin 2
Synonyms: NP2, Npn-2, Npn2, NP-2, 1110048P06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18187
HGNC: HGNC:8005
Homologene: 2875
Tnrc6b
Name: trinucleotide repeat containing 6b
Synonyms: A730065C02Rik, D230019K20Rik, 2700090M07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 213988
VEGA: 15
Homologene: 66194
Slc6a5
Name: solute carrier family 6 (neurotransmitter transporter, glycine), member 5
Synonyms: Glyt2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 104245
Homologene: 37901
Septin3
Name: septin 3
Synonyms: Sep3, B530002E20Rik, 3110018K01Rik, Gm46500, Sept3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 24050
VEGA: 15
Homologene: 99740
Sez6
Name: seizure related gene 6
Synonyms: sez-6, D11Bhm177e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20370
Homologene: 10948
Pepd
Name: peptidase D
Synonyms: Pep-4, peptidase D, Pep4, dal
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18624
HGNC: HGNC:8840
Homologene: 239
Scrib
Name: scribbled planar cell polarity
Synonyms: Scrb1, Crc
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105782
Homologene: 44228
Anxa4
Name: annexin A4
Synonyms: Anx4, Xanx-4, annexin IV, AIV
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11746
HGNC: HGNC:542
Homologene: 68164
Triobp
Name: TRIO and F-actin binding protein
Synonyms: Mus EST 478828, Tara, EST478828
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110253
Homologene: 5104
Kntc1
Name: kinetochore associated 1
Synonyms: jgl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208628
Homologene: 32227
Adgrl2
Name: adhesion G protein-coupled receptor L2
Synonyms: Lphh1, Lec1, Lphn2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99633
Homologene: 22712
Etl4
Name: enhancer trap locus 4
Synonyms: Etl-4, E330027G05Rik, 6620402G01Rik, 9430077C05Rik, Skt, Sickle tail
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208618
Homologene: 10477
Faf1
Name: Fas-associated factor 1
Synonyms: Fam, Dffrx
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14084
HGNC: HGNC:3578
Homologene: 5120
Eif4enif1
Name: eukaryotic translation initiation factor 4E nuclear import factor 1
Synonyms: Clast4, 2610509L04Rik, D11Ertd166e, A930019J01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74203
Homologene: 10522
Dph5
Name: diphthamide biosynthesis 5
Synonyms: 2410012M04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69740
Homologene: 6471
Itpr1
Name: inositol 1,4,5-trisphosphate receptor 1
Synonyms: P400, IP3R1, Itpr-1, Ip3r, Pcp-1, opt, InsP3R type I, Pcp1, wblo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16438
HGNC: HGNC:6180
Homologene: 1673
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Sfxn5
Name: sideroflexin 5
Synonyms: C230001H08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 94282
Homologene: 16936
Sox8
Name: SRY (sex determining region Y)-box 8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20681
Homologene: 7950
Insig2
Name: insulin induced gene 2
Synonyms: Insig-2, 2900053I11Rik, C730043J18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72999
Homologene: 9400
Dnaaf5
Name: dynein, axonemal assembly factor 5
Synonyms: Heatr2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 433956
Homologene: 41198
Muc2
Name: mucin 2
Synonyms: 2010015E03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17831
HGNC: HGNC:7512
Homologene: 136755
Pdgfrb
Name: platelet derived growth factor receptor, beta polypeptide
Synonyms: CD140b, Pdgfr
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18596
HGNC: HGNC:8804
Homologene: 1960
Hsd17b13
Name: hydroxysteroid (17-beta) dehydrogenase 13
Synonyms: Pan1b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243168
Homologene: 71549
Plod1
Name: procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
Synonyms: lysyl hydroxylase 1, LH1, 2410042F05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18822
HGNC: HGNC:9081
Homologene: 256
Sptbn2
Name: spectrin beta, non-erythrocytic 2
Synonyms: Spnb3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20743
VEGA: 19
Homologene: 48482
Hrob
Name: homologous recombination factor with OB-fold
Synonyms: BC030867
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217216
Homologene: 69368
Firrm
Name: FIGNL1 interacting regulator of recombination and mitosis
Synonyms: BC055324, Flip
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381306
Homologene: 10058
Galnt12
Name: polypeptide N-acetylgalactosaminyltransferase 12
Synonyms: A630062B03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230145
Homologene: 11637
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Pitpnm1
Name: phosphatidylinositol transfer protein, membrane-associated 1
Synonyms: RdgB, DRES9
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18739
HGNC: HGNC:9003
Homologene: 3608
Pigo
Name: phosphatidylinositol glycan anchor biosynthesis, class O
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56703
Homologene: 31761
Agbl1
Name: ATP/GTP binding protein-like 1
Synonyms: Nna1-l1, EG244071, Ccp4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244071
Homologene: 17552
Insrr
Name: insulin receptor-related receptor
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 23920
HGNC: HGNC:6093
Homologene: 56539
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Il1r2
Name: interleukin 1 receptor, type II
Synonyms: IL-1 receptor beta chain, CD121b, Il1r-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16178
HGNC: HGNC:5994
Homologene: 7783
Fhip2b
Name: FHF complex subunit HOOK interacting protein 2B
Synonyms: G430067P06Rik, Rai16, Fam160b2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239170
VEGA: 14
Homologene: 23379
Rev3l
Name: REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms: Sez4, Rev
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19714
HGNC: HGNC:9968
Homologene: 48147
Hykk
Name: hydroxylysine kinase 1
Synonyms: C630028N24Rik, Agphd1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235386
Homologene: 16057
Chrnd
Name: cholinergic receptor, nicotinic, delta polypeptide
Synonyms: Achr-4, Acrd
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11447
HGNC: HGNC:1965
Homologene: 37340
Or52e4
Name: olfactory receptor family 52 subfamily E member 4
Synonyms: GA_x6K02T2PBJ9-7685262-7686200, MOR32-11, Olfr677
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258355
Homologene: 81596
Asic1
Name: acid-sensing ion channel 1
Synonyms: BNaC2, ASIC, ASIC1a, ASICalpha, ASIC1 beta, B530003N02Rik, ASIC1b, Accn2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11419
VEGA: 15
HGNC: HGNC:100
Homologene: 121755
Vwa5b1
Name: von Willebrand factor A domain containing 5B1
Synonyms: 4931403E03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75718
Homologene: 19431
Col15a1
Name: collagen, type XV, alpha 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12819
HGNC: HGNC:2192
Homologene: 1396
Ankrd42
Name: ankyrin repeat domain 42
Synonyms: 4933417L02Rik, Ikbn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73845
Homologene: 23652
Cckar
Name: cholecystokinin A receptor
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12425
HGNC: HGNC:1570
Homologene: 37337
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Hdac9
Name: histone deacetylase 9
Synonyms: HDRP, Hdac7b, Mitr, D030072B18Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 79221
Homologene: 128578
H2-T10
Name: histocompatibility 2, T region locus 10
Synonyms: H-2T10
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15024
Pcdhb17
Name: protocadherin beta 17
Synonyms: Pcdhb16, PcdhbQ
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93888
Homologene: 81881
Dcpp3
Name: demilune cell and parotid protein 3
Synonyms: EG620253
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 620253
VEGA: 17
Homologene: 103921
Cfap61
Name: cilia and flagella associated protein 61
Synonyms: 4930529M08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78774
Or5w15
Name: olfactory receptor family 5 subfamily W member 15
Synonyms: GA_x6K02T2Q125-49242149-49241214, MOR177-8, Olfr1138
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258632
Homologene: 74082
Lilra5
Name: leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
Synonyms: Gm4878
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232801
Homologene: 83297
Yipf7
Name: Yip1 domain family, member 7
Synonyms: Yip1b, 2310016N21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75581
Homologene: 69367
Gm10553
Name: predicted gene 10553
Type: Gene
Species: Mouse
Chromosome: 1
Catsper2
Name: cation channel, sperm associated 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 212670
Homologene: 77423
Or5m11b
Name: olfactory receptor family 5 subfamily M member 11B
Synonyms: GA_x6K02T2Q125-47454152-47455126, MOR198-1P, Olfr1029
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258154
Homologene: 73972
Vmn1r125
Name: vomeronasal 1 receptor 125
Synonyms: Gm8519
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667215
Homologene: 104166
Hmx1
Name: H6 homeobox 1
Synonyms: Nkx5-3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15371
HGNC: HGNC:5017
Homologene: 49241
Or8c19
Name: olfactory receptor family 8 subfamily C member 19
Synonyms: GA_x6K02T2PVTD-31999710-32000653, MOR170-7, Or8c19-ps1, Olfr897-ps1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258473
VEGA: 9
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 40,123,202 bp (GRCm38)
  • T to C, chromosome 1 at 62,738,407 bp (GRCm38)
  • T to A, chromosome 1 at 85,100,180 bp (GRCm38)
  • A to T, chromosome 1 at 87,192,589 bp (GRCm38)
  • A to C, chromosome 1 at 121,312,311 bp (GRCm38)
  • A to G, chromosome 1 at 163,994,626 bp (GRCm38)
  • T to A, chromosome 2 at 20,797,913 bp (GRCm38)
  • T to A, chromosome 2 at 85,976,102 bp (GRCm38)
  • T to A, chromosome 2 at 87,738,168 bp (GRCm38)
  • TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT to TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT, chromosome 2 at 121,397,572 bp (GRCm38)
  • T to A, chromosome 2 at 146,012,232 bp (GRCm38)
  • C to T, chromosome 2 at 150,268,184 bp (GRCm38)
  • A to G, chromosome 3 at 38,981,664 bp (GRCm38)
  • A to T, chromosome 3 at 87,814,498 bp (GRCm38)
  • T to A, chromosome 3 at 115,915,043 bp (GRCm38)
  • A to T, chromosome 3 at 148,839,290 bp (GRCm38)
  • C to A, chromosome 4 at 43,017,967 bp (GRCm38)
  • T to C, chromosome 4 at 47,120,390 bp (GRCm38)
  • T to A, chromosome 4 at 47,257,187 bp (GRCm38)
  • T to A, chromosome 4 at 109,794,819 bp (GRCm38)
  • T to A, chromosome 4 at 138,592,109 bp (GRCm38)
  • A to T, chromosome 4 at 143,897,064 bp (GRCm38)
  • C to T, chromosome 4 at 147,931,655 bp (GRCm38)
  • C to T, chromosome 5 at 35,392,056 bp (GRCm38)
  • T to C, chromosome 5 at 53,706,266 bp (GRCm38)
  • T to A, chromosome 5 at 69,521,081 bp (GRCm38)
  • T to C, chromosome 5 at 103,977,107 bp (GRCm38)
  • T to C, chromosome 5 at 123,759,056 bp (GRCm38)
  • T to A, chromosome 5 at 139,166,077 bp (GRCm38)
  • GC to GCTCC, chromosome 6 at 4,756,452 bp (GRCm38)
  • T to A, chromosome 6 at 85,289,213 bp (GRCm38)
  • A to T, chromosome 6 at 86,753,832 bp (GRCm38)
  • A to G, chromosome 6 at 108,394,884 bp (GRCm38)
  • T to C, chromosome 7 at 4,241,908 bp (GRCm38)
  • T to C, chromosome 7 at 21,272,336 bp (GRCm38)
  • A to T, chromosome 7 at 34,921,457 bp (GRCm38)
  • A to T, chromosome 7 at 49,917,748 bp (GRCm38)
  • G to A, chromosome 7 at 76,425,900 bp (GRCm38)
  • A to T, chromosome 7 at 92,624,049 bp (GRCm38)
  • T to C, chromosome 7 at 105,057,167 bp (GRCm38)
  • C to T, chromosome 7 at 141,690,400 bp (GRCm38)
  • T to A, chromosome 9 at 38,308,818 bp (GRCm38)
  • C to T, chromosome 9 at 54,946,237 bp (GRCm38)
  • A to G, chromosome 9 at 88,584,339 bp (GRCm38)
  • A to G, chromosome 10 at 5,229,187 bp (GRCm38)
  • T to C, chromosome 10 at 39,822,444 bp (GRCm38)
  • T to C, chromosome 11 at 3,220,280 bp (GRCm38)
  • A to G, chromosome 11 at 77,976,806 bp (GRCm38)
  • A to T, chromosome 11 at 102,255,760 bp (GRCm38)
  • T to A, chromosome 12 at 34,437,168 bp (GRCm38)
  • T to C, chromosome 14 at 70,590,368 bp (GRCm38)
  • C to T, chromosome 15 at 76,060,643 bp (GRCm38)
  • T to C, chromosome 15 at 79,003,734 bp (GRCm38)
  • T to A, chromosome 15 at 80,889,065 bp (GRCm38)
  • T to C, chromosome 15 at 82,285,887 bp (GRCm38)
  • T to C, chromosome 15 at 99,695,533 bp (GRCm38)
  • A to T, chromosome 17 at 23,919,182 bp (GRCm38)
  • A to T, chromosome 17 at 25,567,897 bp (GRCm38)
  • A to T, chromosome 17 at 36,120,265 bp (GRCm38)
  • A to G, chromosome 17 at 52,797,545 bp (GRCm38)
  • A to T, chromosome 18 at 37,485,418 bp (GRCm38)
  • T to A, chromosome 18 at 61,078,649 bp (GRCm38)
  • G to A, chromosome 19 at 4,103,269 bp (GRCm38)
  • G to T, chromosome 19 at 4,745,313 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9646 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069439-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.