Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9655Btlr/Mmmh
Stock Number:
069448-MU
Citation ID:
RRID:MMRRC_069448-MU
Other Names:
R9655 (G1)
Major Collection:

Strain Information

Nkx2-1
Name: NK2 homeobox 1
Synonyms: thyroid-specific enhancer-binding protein, T/EBP, tinman, Ttf-1, thyroid transcription factor-1, Titf1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 21869
Homologene: 2488
Rtn4
Name: reticulon 4
Synonyms: 1110020G17Rik, C130026I10Rik, NOGO, NgA, Nogo-B, Nogo-A
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68585
Homologene: 10743
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Golga5
Name: golgin A5
Synonyms: Ret-II
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 27277
VEGA: 12
HGNC: HGNC:4428
Homologene: 38009
Glod4
Name: glyoxalase domain containing 4
Synonyms: 1700082G03Rik, 2700085E05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67201
Homologene: 9376
Fbxo42
Name: F-box protein 42
Synonyms: 6720460I06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 213499
Homologene: 16234
Mcm5
Name: minichromosome maintenance complex component 5
Synonyms: mCD46, Cdc46, Mcmd5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17218
HGNC: HGNC:6948
Homologene: 4904
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 36,421,615 bp (GRCm38)
  • T to A, chromosome 1 at 92,939,389 bp (GRCm38)
  • A to T, chromosome 1 at 164,194,161 bp (GRCm38)
  • A to T, chromosome 2 at 29,779,821 bp (GRCm38)
  • A to T, chromosome 2 at 119,520,374 bp (GRCm38)
  • A to G, chromosome 2 at 121,955,168 bp (GRCm38)
  • A to G, chromosome 2 at 153,719,994 bp (GRCm38)
  • C to A, chromosome 2 at 163,732,350 bp (GRCm38)
  • T to A, chromosome 3 at 75,333,254 bp (GRCm38)
  • T to A, chromosome 3 at 88,109,421 bp (GRCm38)
  • A to T, chromosome 3 at 108,374,783 bp (GRCm38)
  • T to C, chromosome 3 at 116,923,191 bp (GRCm38)
  • G to T, chromosome 3 at 151,542,813 bp (GRCm38)
  • G to A, chromosome 3 at 154,939,773 bp (GRCm38)
  • G to T, chromosome 4 at 46,815,684 bp (GRCm38)
  • C to T, chromosome 4 at 52,825,526 bp (GRCm38)
  • C to A, chromosome 4 at 108,377,419 bp (GRCm38)
  • T to A, chromosome 4 at 118,916,607 bp (GRCm38)
  • A to T, chromosome 4 at 141,167,860 bp (GRCm38)
  • A to G, chromosome 4 at 145,086,735 bp (GRCm38)
  • A to T, chromosome 4 at 155,438,208 bp (GRCm38)
  • T to A, chromosome 5 at 3,605,653 bp (GRCm38)
  • C to T, chromosome 5 at 31,487,632 bp (GRCm38)
  • A to G, chromosome 5 at 51,548,510 bp (GRCm38)
  • G to A, chromosome 5 at 63,807,225 bp (GRCm38)
  • G to A, chromosome 5 at 75,961,828 bp (GRCm38)
  • A to T, chromosome 5 at 110,614,238 bp (GRCm38)
  • A to G, chromosome 5 at 124,451,330 bp (GRCm38)
  • A to G, chromosome 5 at 139,973,209 bp (GRCm38)
  • A to T, chromosome 5 at 150,438,786 bp (GRCm38)
  • T to A, chromosome 6 at 3,373,578 bp (GRCm38)
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp (GRCm38)
  • C to T, chromosome 6 at 49,087,404 bp (GRCm38)
  • C to T, chromosome 7 at 24,199,118 bp (GRCm38)
  • A to G, chromosome 7 at 102,955,112 bp (GRCm38)
  • A to G, chromosome 7 at 120,831,056 bp (GRCm38)
  • A to G, chromosome 7 at 127,866,941 bp (GRCm38)
  • T to A, chromosome 7 at 131,138,966 bp (GRCm38)
  • T to A, chromosome 8 at 13,759,153 bp (GRCm38)
  • T to A, chromosome 8 at 33,576,756 bp (GRCm38)
  • C to T, chromosome 8 at 75,117,540 bp (GRCm38)
  • T to A, chromosome 8 at 84,924,031 bp (GRCm38)
  • C to T, chromosome 9 at 15,265,423 bp (GRCm38)
  • A to T, chromosome 9 at 38,048,091 bp (GRCm38)
  • A to G, chromosome 9 at 74,863,048 bp (GRCm38)
  • A to T, chromosome 9 at 85,844,199 bp (GRCm38)
  • T to A, chromosome 9 at 121,965,104 bp (GRCm38)
  • A to T, chromosome 10 at 75,608,801 bp (GRCm38)
  • A to T, chromosome 10 at 80,656,211 bp (GRCm38)
  • A to T, chromosome 10 at 99,126,112 bp (GRCm38)
  • A to G, chromosome 11 at 29,707,504 bp (GRCm38)
  • A to T, chromosome 11 at 48,894,972 bp (GRCm38)
  • A to G, chromosome 11 at 50,168,783 bp (GRCm38)
  • A to G, chromosome 11 at 70,440,247 bp (GRCm38)
  • A to C, chromosome 11 at 76,234,466 bp (GRCm38)
  • G to T, chromosome 11 at 99,014,508 bp (GRCm38)
  • A to C, chromosome 11 at 100,015,798 bp (GRCm38)
  • A to G, chromosome 11 at 102,008,655 bp (GRCm38)
  • G to A, chromosome 11 at 118,080,823 bp (GRCm38)
  • T to C, chromosome 12 at 24,997,296 bp (GRCm38)
  • T to A, chromosome 12 at 56,535,017 bp (GRCm38)
  • A to T, chromosome 12 at 65,226,933 bp (GRCm38)
  • C to T, chromosome 12 at 102,479,749 bp (GRCm38)
  • C to T, chromosome 12 at 115,067,796 bp (GRCm38)
  • A to G, chromosome 13 at 12,188,144 bp (GRCm38)
  • A to T, chromosome 13 at 24,725,000 bp (GRCm38)
  • T to C, chromosome 14 at 54,625,508 bp (GRCm38)
  • A to G, chromosome 14 at 101,507,131 bp (GRCm38)
  • T to C, chromosome 14 at 121,912,580 bp (GRCm38)
  • T to A, chromosome 15 at 5,011,982 bp (GRCm38)
  • A to G, chromosome 15 at 28,242,754 bp (GRCm38)
  • C to T, chromosome 15 at 36,534,436 bp (GRCm38)
  • A to T, chromosome 15 at 58,134,907 bp (GRCm38)
  • A to G, chromosome 15 at 99,943,092 bp (GRCm38)
  • A to G, chromosome 15 at 102,104,498 bp (GRCm38)
  • A to T, chromosome 16 at 46,154,201 bp (GRCm38)
  • T to A, chromosome 17 at 6,991,735 bp (GRCm38)
  • T to A, chromosome 17 at 17,877,356 bp (GRCm38)
  • A to G, chromosome 17 at 24,880,691 bp (GRCm38)
  • A to G, chromosome 18 at 37,690,232 bp (GRCm38)
  • G to T, chromosome 18 at 37,732,069 bp (GRCm38)
  • A to G, chromosome 19 at 18,892,102 bp (GRCm38)
  • C to T, chromosome 19 at 28,892,883 bp (GRCm38)
  • T to A, chromosome 19 at 40,160,677 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9655 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069448-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.