Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9678Btlr/Mmmh
Stock Number:
069471-MU
Citation ID:
RRID:MMRRC_069471-MU
Other Names:
R9678 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Pik3r1
Name: phosphoinositide-3-kinase regulatory subunit 1
Synonyms: p85alpha, p50alpha, p55alpha, PI3K
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18708
HGNC: HGNC:8979
Homologene: 7889
Tagln3
Name: transgelin 3
Synonyms: 2900005O10Rik, 2700038H05Rik, Np25
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 56370
Homologene: 22337
Adgre1
Name: adhesion G protein-coupled receptor E1
Synonyms: F4/80, DD7A5-7, TM7LN3, EGF-TM7, Ly71, Emr1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13733
VEGA: 17
HGNC: HGNC:3336
Homologene: 1493
Cdca2
Name: cell division cycle associated 2
Synonyms: 2610311M19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 108912
Homologene: 18444
Trpm7
Name: transient receptor potential cation channel, subfamily M, member 7
Synonyms: 5033407O22Rik, 4833414K03Rik, Ltpr7, CHAK1, CHAK, TRP-PLIK, 2310022G15Rik, LTRPC7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 58800
Homologene: 9774
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 37,366,871 bp (GRCm38)
  • A to G, chromosome 1 at 180,810,115 bp (GRCm38)
  • A to T, chromosome 2 at 67,509,444 bp (GRCm38)
  • C to A, chromosome 2 at 126,844,370 bp (GRCm38)
  • A to T, chromosome 2 at 145,919,955 bp (GRCm38)
  • A to G, chromosome 3 at 75,139,534 bp (GRCm38)
  • A to G, chromosome 4 at 125,102,896 bp (GRCm38)
  • A to G, chromosome 5 at 65,424,127 bp (GRCm38)
  • A to C, chromosome 5 at 87,125,327 bp (GRCm38)
  • A to G, chromosome 5 at 91,594,285 bp (GRCm38)
  • A to G, chromosome 5 at 109,216,175 bp (GRCm38)
  • T to C, chromosome 6 at 37,965,514 bp (GRCm38)
  • T to A, chromosome 6 at 68,632,240 bp (GRCm38)
  • T to C, chromosome 6 at 92,211,638 bp (GRCm38)
  • C to A, chromosome 6 at 129,353,665 bp (GRCm38)
  • T to C, chromosome 7 at 81,559,701 bp (GRCm38)
  • A to G, chromosome 7 at 96,737,412 bp (GRCm38)
  • C to T, chromosome 7 at 126,674,364 bp (GRCm38)
  • C to A, chromosome 7 at 142,189,986 bp (GRCm38)
  • T to C, chromosome 7 at 143,460,646 bp (GRCm38)
  • C to T, chromosome 9 at 95,910,557 bp (GRCm38)
  • T to C, chromosome 9 at 104,023,487 bp (GRCm38)
  • G to T, chromosome 10 at 12,739,415 bp (GRCm38)
  • C to T, chromosome 10 at 78,611,883 bp (GRCm38)
  • T to C, chromosome 11 at 22,151,108 bp (GRCm38)
  • T to C, chromosome 11 at 83,016,897 bp (GRCm38)
  • G to T, chromosome 11 at 113,794,963 bp (GRCm38)
  • TGTGCCGGTGCCGGTGCCGGTGCCGGTGCC to TGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCC, chromosome 12 at 40,844,380 bp (GRCm38)
  • TGCCGG to TGCCGGCGCCGG, chromosome 12 at 40,844,388 bp (GRCm38)
  • CGGTGC to CGGTGCGGGTGC, chromosome 12 at 40,844,397 bp (GRCm38)
  • G to T, chromosome 13 at 101,702,781 bp (GRCm38)
  • A to T, chromosome 14 at 43,015,567 bp (GRCm38)
  • A to G, chromosome 14 at 51,456,054 bp (GRCm38)
  • A to T, chromosome 14 at 67,700,329 bp (GRCm38)
  • A to T, chromosome 14 at 122,491,026 bp (GRCm38)
  • T to A, chromosome 16 at 45,724,242 bp (GRCm38)
  • A to G, chromosome 16 at 58,926,277 bp (GRCm38)
  • A to G, chromosome 17 at 34,741,789 bp (GRCm38)
  • A to G, chromosome 17 at 57,443,997 bp (GRCm38)
  • A to T, chromosome 19 at 57,458,117 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9678 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069471-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.