Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9684Btlr/Mmmh
Stock Number:
069477-MU
Citation ID:
RRID:MMRRC_069477-MU
Other Names:
R9684 (G1)
Major Collection:

Strain Information

Cdh11
Name: cadherin 11
Synonyms: osteoblast-cadherin, OB-cadherin, Cad11
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12552
HGNC: HGNC:1750
Homologene: 1361
Ehmt1
Name: euchromatic histone methyltransferase 1
Synonyms: 9230102N17Rik, KMT1D
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77683
Homologene: 11698
Cdk19
Name: cyclin dependent kinase 19
Synonyms: 2700084L06Rik, Cdc2l6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 78334
VEGA: 10
Homologene: 22862
Cryzl1
Name: crystallin zeta like 1
Synonyms: 2210407J23Rik, 2410006O11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66609
HGNC: HGNC:2420
Homologene: 3749
Vmp1
Name: vacuole membrane protein 1
Synonyms: 4930579A11Rik, 3110098I04Rik, Tmem49, Tango5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75909
Homologene: 23686
Syncrip
Name: synaptotagmin binding, cytoplasmic RNA interacting protein
Synonyms: RRM RNA binding protein GRY-RBP, GRY-RBP, pp68, Nsap1l, Nsap1, 4632417O19Rik, 2610109K23Rik, hnRNP Q
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56403
Homologene: 4648
Slc10a7
Name: solute carrier family 10 (sodium/bile acid cotransporter family), member 7
Synonyms: 2410193C02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76775
Homologene: 81628
Ccnt1
Name: cyclin T1
Synonyms: CycT1, 2810478G24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12455
HGNC: HGNC:1599
Homologene: 947
Ncor2
Name: nuclear receptor co-repressor 2
Synonyms: SMRTe, SMRT
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20602
HGNC: HGNC:7673
Homologene: 31370
Pcsk9
Name: proprotein convertase subtilisin/kexin type 9
Synonyms: Narc1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100102
Homologene: 17790
Orc3
Name: origin recognition complex, subunit 3
Synonyms: Orc3l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50793
HGNC: HGNC:8489
Homologene: 8225
Ralgapa1
Name: Ral GTPase activating protein, alpha subunit 1
Synonyms: 4930400K19Rik, Tulip1, 2310003F20Rik, Garnl1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56784
VEGA: 12
Homologene: 84805
Tnfrsf9
Name: tumor necrosis factor receptor superfamily, member 9
Synonyms: 4-1BB, CDw137, Ly63, Cd137, ILA, A930040I11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21942
Homologene: 1199
Asb4
Name: ankyrin repeat and SOCS box-containing 4
Synonyms: 8430401O13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 65255
Homologene: 9392
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
M1ap
Name: meiosis 1 associated protein
Synonyms: D6Mm5e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 110958
Homologene: 13210
Dolpp1
Name: dolichyl pyrophosphate phosphatase 1
Synonyms: LSFR2, 0610011H20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 57170
Homologene: 10663
Zfp599
Name: zinc finger protein 599
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235048
Homologene: 138456
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Vmn1r33
Name: vomeronasal 1 receptor 33
Synonyms: V1rc14
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171187
Homologene: 110800
Def6
Name: differentially expressed in FDCP 6
Synonyms: 2410003F05Rik, 6430538D02Rik, IRF-4-binding protein, IBP, SLAT
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 23853
HGNC: HGNC:2760
Homologene: 11103
Ces2c
Name: carboxylesterase 2C
Synonyms: Ces2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234671
HGNC: HGNC:1864
Homologene: 138298
Ermp1
Name: endoplasmic reticulum metallopeptidase 1
Synonyms: D19Ertd410e, D19Wsu12e, b2b2633Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226090
Homologene: 121891
Npr2
Name: natriuretic peptide receptor 2
Synonyms: guanylyl cyclase-B, cn, pwe
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230103
HGNC: HGNC:7944
Homologene: 2970
Or56a3
Name: olfactory receptor family 56 subfamily A member 3
Synonyms: GA_x6K02T2PBJ9-7714499-7715446, MOR40-2, Olfr679
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259046
Homologene: 81538
Nepn
Name: nephrocan
Synonyms: 5730521E12Rik, Npn, periolin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66650
Homologene: 23549
Gbp7
Name: guanylate binding protein 7
Synonyms: 9830147J24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229900
Homologene: 138296
Slc25a32
Name: solute carrier family 25, member 32
Synonyms: 2610043O12Rik, Mftc
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69906
VEGA: 15
Homologene: 6151
Vmn1r63
Name: vomeronasal 1 receptor 63
Synonyms: V1R1, V1rd1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81017
Homologene: 41799
F830016B08Rik
Name: RIKEN cDNA F830016B08 gene
Synonyms: Ifgga4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240328
VEGA: 18
Homologene: 129714
Hdac10
Name: histone deacetylase 10
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170787
Homologene: 23749
Niban1
Name: niban apoptosis regulator 1
Synonyms: Niban, Fam129a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 63913
Homologene: 62170
Myoz3
Name: myozenin 3
Synonyms: calsarcin-3, Fatz-3, 4833419K08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 170947
Homologene: 15782
Vdr
Name: vitamin D (1,25-dihydroxyvitamin D3) receptor
Synonyms: Nr1i1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22337
Homologene: 37297
Or51i1
Name: olfactory receptor family 51 subfamily I member 1D
Synonyms: GA_x6K02T2PBJ9-6756759-6755815, MOR13-4, Olfr640
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258819
Homologene: 17404
Tc2n
Name: tandem C2 domains, nuclear
Synonyms: 4933406D09Rik, Tac2-N, Mtac2d1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74413
Homologene: 12560
Cox10
Name: heme A:farnesyltransferase cytochrome c oxidase assembly factor 10
Synonyms: 2410004F01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70383
HGNC: HGNC:2260
Homologene: 80170
Acot3
Name: acyl-CoA thioesterase 3
Synonyms: PTE-Ia, Pte2a
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 171281
Homologene: 134585
Spesp1
Name: sperm equatorial segment protein 1
Synonyms: 4921508E09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66712
VEGA: 9
Homologene: 49838
Krt32
Name: keratin 32
Synonyms: mHa2, Krt1-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16670
HGNC: HGNC:6449
Homologene: 68246
Ube2r2
Name: ubiquitin-conjugating enzyme E2R 2
Synonyms: Cdc34b, Ubc3b, 1200003M11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67615
Homologene: 3210
Ppm1k
Name: protein phosphatase 1K (PP2C domain containing)
Synonyms: 2900063A19Rik, A930026L03Rik, PP2Cm
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243382
Homologene: 36819
Mfsd3
Name: major facilitator superfamily domain containing 3
Synonyms: 2310010G13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69572
VEGA: 15
Homologene: 12318
Ghdc
Name: GH3 domain containing
Synonyms: D11Lgp1e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 80860
Homologene: 32760
Selp
Name: selectin, platelet
Synonyms: CD62P, P-selectin, Grmp
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20344
Homologene: 2260
Oosp3
Name: oocyte secreted protein 3
Synonyms: LOC225923, Gm97
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225923
Gzmf
Name: granzyme F
Synonyms: granzyme G, MCSP-3, CCP4, CTL serine protease 3, Ctla-7, Ctla7
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14943
VEGA: 14
Homologene: 133275
Pcdhga7
Name: protocadherin gamma subfamily A, 7
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93715
HGNC: HGNC:8705
Homologene: 36377
Pnma1
Name: paraneoplastic antigen MA1
Synonyms: 5730402C15Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70481
HGNC: HGNC:9158
Homologene: 4399
Gm45861
Name: predicted gene 45861
Type: Gene
Species: Mouse
Chromosome: 8
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 151,717,787 bp (GRCm38)
  • T to A, chromosome 1 at 164,126,289 bp (GRCm38)
  • A to C, chromosome 1 at 188,399,881 bp (GRCm38)
  • T to C, chromosome 2 at 24,863,317 bp (GRCm38)
  • A to G, chromosome 2 at 30,395,736 bp (GRCm38)
  • T to C, chromosome 2 at 180,207,245 bp (GRCm38)
  • A to G, chromosome 3 at 142,534,566 bp (GRCm38)
  • G to A, chromosome 4 at 34,607,135 bp (GRCm38)
  • A to G, chromosome 4 at 41,183,329 bp (GRCm38)
  • T to C, chromosome 4 at 43,632,491 bp (GRCm38)
  • G to T, chromosome 4 at 106,450,189 bp (GRCm38)
  • C to T, chromosome 4 at 150,934,408 bp (GRCm38)
  • A to G, chromosome 5 at 125,025,075 bp (GRCm38)
  • A to C, chromosome 6 at 5,398,296 bp (GRCm38)
  • T to A, chromosome 6 at 57,510,777 bp (GRCm38)
  • T to C, chromosome 6 at 66,612,091 bp (GRCm38)
  • C to A, chromosome 6 at 82,968,113 bp (GRCm38)
  • A to G, chromosome 7 at 5,802,914 bp (GRCm38)
  • C to A, chromosome 7 at 104,021,872 bp (GRCm38)
  • A to G, chromosome 7 at 105,086,382 bp (GRCm38)
  • A to G, chromosome 7 at 141,811,061 bp (GRCm38)
  • A to G, chromosome 8 at 27,524,573 bp (GRCm38)
  • T to A, chromosome 8 at 78,729,675 bp (GRCm38)
  • A to G, chromosome 8 at 102,664,695 bp (GRCm38)
  • A to C, chromosome 8 at 104,848,067 bp (GRCm38)
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp (GRCm38)
  • G to A, chromosome 9 at 22,249,528 bp (GRCm38)
  • A to G, chromosome 9 at 62,273,263 bp (GRCm38)
  • T to C, chromosome 9 at 88,479,618 bp (GRCm38)
  • T to A, chromosome 10 at 40,475,598 bp (GRCm38)
  • T to C, chromosome 10 at 52,400,705 bp (GRCm38)
  • G to A, chromosome 10 at 120,038,664 bp (GRCm38)
  • A to T, chromosome 11 at 9,333,307 bp (GRCm38)
  • C to T, chromosome 11 at 63,964,381 bp (GRCm38)
  • T to C, chromosome 11 at 86,585,330 bp (GRCm38)
  • T to A, chromosome 11 at 100,086,482 bp (GRCm38)
  • A to G, chromosome 11 at 100,770,265 bp (GRCm38)
  • T to C, chromosome 12 at 55,612,700 bp (GRCm38)
  • T to C, chromosome 12 at 84,058,876 bp (GRCm38)
  • T to C, chromosome 12 at 84,147,167 bp (GRCm38)
  • T to C, chromosome 12 at 101,694,559 bp (GRCm38)
  • T to A, chromosome 14 at 56,206,987 bp (GRCm38)
  • T to C, chromosome 15 at 39,105,944 bp (GRCm38)
  • A to G, chromosome 15 at 76,702,983 bp (GRCm38)
  • C to A, chromosome 15 at 89,127,199 bp (GRCm38)
  • A to G, chromosome 15 at 97,869,404 bp (GRCm38)
  • A to T, chromosome 15 at 98,548,685 bp (GRCm38)
  • A to G, chromosome 16 at 91,690,746 bp (GRCm38)
  • T to C, chromosome 17 at 28,217,070 bp (GRCm38)
  • T to C, chromosome 18 at 37,715,614 bp (GRCm38)
  • T to C, chromosome 18 at 60,299,971 bp (GRCm38)
  • T to C, chromosome 18 at 60,578,954 bp (GRCm38)
  • A to T, chromosome 19 at 11,705,442 bp (GRCm38)
  • G to T, chromosome 19 at 29,616,706 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9684 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069477-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.