Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9684Btlr/Mmmh
Stock Number:
069477-MU
Citation ID:
RRID:MMRRC_069477-MU
Other Names:
R9684 (G1)
Major Collection:

Strain Information

Cdh11
Name: cadherin 11
Synonyms: osteoblast-cadherin, OB-cadherin, Cad11
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12552
HGNC: HGNC:1750
Homologene: 1361
Ehmt1
Name: euchromatic histone methyltransferase 1
Synonyms: 9230102N17Rik, KMT1D
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77683
Homologene: 11698
Cdk19
Name: cyclin dependent kinase 19
Synonyms: 2700084L06Rik, Cdc2l6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 78334
VEGA: 10
Homologene: 22862
Cryzl1
Name: crystallin zeta like 1
Synonyms: 2210407J23Rik, 2410006O11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66609
HGNC: HGNC:2420
Homologene: 3749
Vmp1
Name: vacuole membrane protein 1
Synonyms: 4930579A11Rik, 3110098I04Rik, Tmem49, Tango5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75909
Homologene: 23686
Syncrip
Name: synaptotagmin binding, cytoplasmic RNA interacting protein
Synonyms: RRM RNA binding protein GRY-RBP, GRY-RBP, pp68, Nsap1l, Nsap1, 4632417O19Rik, 2610109K23Rik, hnRNP Q
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56403
Homologene: 4648
Slc10a7
Name: solute carrier family 10 (sodium/bile acid cotransporter family), member 7
Synonyms: 2410193C02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76775
Homologene: 81628
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 151,717,787 bp (GRCm38)
  • T to A, chromosome 1 at 164,126,289 bp (GRCm38)
  • A to C, chromosome 1 at 188,399,881 bp (GRCm38)
  • T to C, chromosome 2 at 24,863,317 bp (GRCm38)
  • A to G, chromosome 2 at 30,395,736 bp (GRCm38)
  • T to C, chromosome 2 at 180,207,245 bp (GRCm38)
  • A to G, chromosome 3 at 142,534,566 bp (GRCm38)
  • G to A, chromosome 4 at 34,607,135 bp (GRCm38)
  • A to G, chromosome 4 at 41,183,329 bp (GRCm38)
  • T to C, chromosome 4 at 43,632,491 bp (GRCm38)
  • G to T, chromosome 4 at 106,450,189 bp (GRCm38)
  • C to T, chromosome 4 at 150,934,408 bp (GRCm38)
  • A to G, chromosome 5 at 125,025,075 bp (GRCm38)
  • A to C, chromosome 6 at 5,398,296 bp (GRCm38)
  • T to A, chromosome 6 at 57,510,777 bp (GRCm38)
  • T to C, chromosome 6 at 66,612,091 bp (GRCm38)
  • C to A, chromosome 6 at 82,968,113 bp (GRCm38)
  • A to G, chromosome 7 at 5,802,914 bp (GRCm38)
  • C to A, chromosome 7 at 104,021,872 bp (GRCm38)
  • A to G, chromosome 7 at 105,086,382 bp (GRCm38)
  • A to G, chromosome 7 at 141,811,061 bp (GRCm38)
  • A to G, chromosome 8 at 27,524,573 bp (GRCm38)
  • T to A, chromosome 8 at 78,729,675 bp (GRCm38)
  • A to G, chromosome 8 at 102,664,695 bp (GRCm38)
  • A to C, chromosome 8 at 104,848,067 bp (GRCm38)
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp (GRCm38)
  • G to A, chromosome 9 at 22,249,528 bp (GRCm38)
  • A to G, chromosome 9 at 62,273,263 bp (GRCm38)
  • T to C, chromosome 9 at 88,479,618 bp (GRCm38)
  • T to A, chromosome 10 at 40,475,598 bp (GRCm38)
  • T to C, chromosome 10 at 52,400,705 bp (GRCm38)
  • G to A, chromosome 10 at 120,038,664 bp (GRCm38)
  • A to T, chromosome 11 at 9,333,307 bp (GRCm38)
  • C to T, chromosome 11 at 63,964,381 bp (GRCm38)
  • T to C, chromosome 11 at 86,585,330 bp (GRCm38)
  • T to A, chromosome 11 at 100,086,482 bp (GRCm38)
  • A to G, chromosome 11 at 100,770,265 bp (GRCm38)
  • T to C, chromosome 12 at 55,612,700 bp (GRCm38)
  • T to C, chromosome 12 at 84,058,876 bp (GRCm38)
  • T to C, chromosome 12 at 84,147,167 bp (GRCm38)
  • T to C, chromosome 12 at 101,694,559 bp (GRCm38)
  • T to A, chromosome 14 at 56,206,987 bp (GRCm38)
  • T to C, chromosome 15 at 39,105,944 bp (GRCm38)
  • A to G, chromosome 15 at 76,702,983 bp (GRCm38)
  • C to A, chromosome 15 at 89,127,199 bp (GRCm38)
  • A to G, chromosome 15 at 97,869,404 bp (GRCm38)
  • A to T, chromosome 15 at 98,548,685 bp (GRCm38)
  • A to G, chromosome 16 at 91,690,746 bp (GRCm38)
  • T to C, chromosome 17 at 28,217,070 bp (GRCm38)
  • T to C, chromosome 18 at 37,715,614 bp (GRCm38)
  • T to C, chromosome 18 at 60,299,971 bp (GRCm38)
  • T to C, chromosome 18 at 60,578,954 bp (GRCm38)
  • A to T, chromosome 19 at 11,705,442 bp (GRCm38)
  • G to T, chromosome 19 at 29,616,706 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9684 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069477-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.