Strain Name:
C57BL/6J-MtgxR9696Btlr/Mmmh
Stock Number:
069489-MU
Citation ID:
RRID:MMRRC_069489-MU
Other Names:
R9696 (G1)
Major Collection:

Strain Information

Epha2
Name: Eph receptor A2
Synonyms: Sek-2, Eck, Sek2, Myk2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13836
HGNC: HGNC:3386
Homologene: 20929
Krt5
Name: keratin 5
Synonyms: 3300001P10Rik, K5, Krt2-5, Tfip8
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110308
HGNC: HGNC:6442
Homologene: 55461
Cacna1h
Name: calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms: alpha13.2, Cav3.2, T-type Cav3.2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 58226
HGNC: HGNC:1395
Homologene: 56913
Hgf
Name: hepatocyte growth factor
Synonyms: NK2, SF/HGF, HGF/SF, C230052L06Rik, scatter factor, NK1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15234
HGNC: HGNC:4893
Homologene: 503
Med1
Name: mediator complex subunit 1
Synonyms: TRAP 220, TRAP220, PBP, CRSP210, DRIP205, Pparbp, l11Jus15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Uri1
Name: URI1, prefoldin-like chaperone
Synonyms: Rmp, NNX3, C80913
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19777
Homologene: 2813
Ciapin1
Name: cytokine induced apoptosis inhibitor 1
Synonyms: anamorsin, 2810413N20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109006
Homologene: 10658
Rabep1
Name: rabaptin, RAB GTPase binding effector protein 1
Synonyms: neurocrescin, rabaptin-5, RAB5 effector protein
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54189
Homologene: 3451
Cop1
Name: COP1, E3 ubiquitin ligase
Synonyms: Cop1, Rfwd2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26374
Homologene: 115565
Gse1
Name: genetic suppressor element 1, coiled-coil protein
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382034
Homologene: 40964
Lin9
Name: lin-9 DREAM MuvB core complex component
Synonyms: 2700022J23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72568
Homologene: 35252
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: D630005A10Rik, apollon, A430032G04Rik, A430040A19Rik, Bruce
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Daam1
Name: dishevelled associated activator of morphogenesis 1
Synonyms: 1700066F09Rik, 2310028E21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 208846
VEGA: 12
Homologene: 36635
Mbtd1
Name: mbt domain containing 1
Synonyms: hemp
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103537
Homologene: 41185
Med25
Name: mediator complex subunit 25
Synonyms: 2610034E13Rik, 2610529E18Rik, ESTM2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75613
Homologene: 12614
Ogdh
Name: oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Synonyms: 2210412K19Rik, 2210403E04Rik, alpha-ketoglutarate dehydrogenase, d1401
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18293
HGNC: HGNC:8124
Homologene: 55662
Mapk1ip1l
Name: mitogen-activated protein kinase 1 interacting protein 1-like
Synonyms: C130032J12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218975
VEGA: 14
Homologene: 44893
Dcaf13
Name: DDB1 and CUL4 associated factor 13
Synonyms: Wdsof1, LOC223499
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223499
Homologene: 6430
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: SYNE-1, A330049M09Rik, enaptin165, nesprin-1, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Sec23b
Name: SEC23 homolog B, COPII coat complex component
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27054
Homologene: 74571
Strn3
Name: striatin, calmodulin binding protein 3
Synonyms: SG2NA
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 94186
VEGA: 12
Homologene: 82078
Nat10
Name: N-acetyltransferase 10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98956
Homologene: 6785
Vps13b
Name: vacuolar protein sorting 13B
Synonyms: C330002D13Rik, Coh1, 1810042B05Rik, 2310042E16Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 666173
VEGA: 15
HGNC: HGNC:2183
Homologene: 49516
Scaf4
Name: SR-related CTD-associated factor 4
Synonyms: Srsf15, Sfrs15, Sra4
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224432
VEGA: 16
Homologene: 16227
Insig1
Name: insulin induced gene 1
Synonyms: 1810013C12Rik, Insig-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231070
HGNC: HGNC:6083
Homologene: 4047
Rab10
Name: RAB10, member RAS oncogene family
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19325
VEGA: 12
HGNC: HGNC:9759
Homologene: 41111
Exosc10
Name: exosome component 10
Synonyms: Pmscl2, p2, p3, p4, RRP6, PM-Scl, PM/Scl-100
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50912
HGNC: HGNC:9138
Homologene: 31105
Mfsd14b
Name: major facilitator superfamily domain containing 14B
Synonyms: Hiatl1, 5730414C17Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66631
Homologene: 64464
Memo1
Name: mediator of cell motility 1
Synonyms: D930048L02Rik, 0610016J10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76890
VEGA: 17
Homologene: 6272
Pcdhb18
Name: protocadherin beta 18
Synonyms: PcdhbR, Pcdhb9
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93889
Homologene: 137649
Peg10
Name: paternally expressed 10
Synonyms: Rtl2, MEF3L, MyEF-3, Mar2, MyEF-3 like, Edr, HB-1, Mart2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Adam20
Name: a disintegrin and metallopeptidase domain 20
Synonyms: 4930529F22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 384806
HGNC: HGNC:199
Homologene: 128364
Arap3
Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
Synonyms: DRAG1, E030006K04Rik, Centd3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106952
VEGA: 18
Homologene: 11199
Gm11992
Name: predicted gene 11992
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 626870
Homologene: 77951
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Nlrp9a
Name: NLR family, pyrin domain containing 9A
Synonyms: Nalp-theta, Nalp9a, D7Ertd565e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233001
Homologene: 116072
Rnf213
Name: ring finger protein 213
Synonyms: D11Ertd759e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 672511
Homologene: 45439
Lcn5
Name: lipocalin 5
Synonyms: mE-RABP, Erabp, MEP10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13863
Homologene: 7305
Magi2
Name: membrane associated guanylate kinase, WW and PDZ domain containing 2
Synonyms: Acvrinp1, Magi-2, S-SCAM
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50791
Homologene: 8189
Tdrd7
Name: tudor domain containing 7
Synonyms: 5730495N10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100121
Homologene: 8618
4930407I10Rik
Name: RIKEN cDNA 4930407I10 gene
Synonyms: LOC328573
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 328573
VEGA: 15
Homologene: 130065
Unc13a
Name: unc-13 homolog A
Synonyms: Munc13-1, 2410078G03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382018
Homologene: 11279
Fmnl1
Name: formin-like 1
Synonyms: formin-related gene in leukocytes, 8030453N10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 57778
HGNC: HGNC:1212
Homologene: 135620
Abca14
Name: ATP-binding cassette, sub-family A member 14
Synonyms: 4930539G24Rik, 1700110B15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67928
Homologene: 86128
Samd9l
Name: sterile alpha motif domain containing 9-like
Synonyms: ESTM25
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 209086
HGNC: HGNC:1349
Homologene: 7707
Me1
Name: malic enzyme 1, NADP(+)-dependent, cytosolic
Synonyms: Mod1, Mod-1, D9Ertd267e, Mdh-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17436
HGNC: HGNC:6983
Homologene: 134785
Haus1
Name: HAUS augmin-like complex, subunit 1
Synonyms: spindle associated, Ccdc5, HEI-C
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225745
VEGA: 18
Homologene: 15516
Stmnd1
Name: stathmin domain containing 1
Synonyms: Gm1574, LOC380842
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 380842
VEGA: 13
Homologene: 54416
Disp3
Name: dispatched RND transporter family member 3
Synonyms: Ptchd2, G630052C06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242748
Homologene: 25712
Tgs1
Name: trimethylguanosine synthase 1
Synonyms: Pimt, Ncoa6ip, D4Ertd800e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 116940
Homologene: 32608
Pcnp
Name: PEST proteolytic signal containing nuclear protein
Synonyms: 1110018D06Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 76302
Homologene: 10676
Ercc4
Name: excision repair cross-complementing rodent repair deficiency, complementation group 4
Synonyms: Xpf
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 50505
HGNC: HGNC:3436
Homologene: 3836
Sncaip
Name: synuclein, alpha interacting protein (synphilin)
Synonyms: synphilin-1, SYPH1, 4933427B05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67847
Homologene: 3987
Parl
Name: presenilin associated, rhomboid-like
Synonyms: PSENIP2, PSARL1, PRO2207, D16Ertd607e, Psarl
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 381038
Homologene: 10239
Ccdc8
Name: coiled-coil domain containing 8
Synonyms: ENSMUSG00000041117
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434130
Homologene: 49977
Scnn1b
Name: sodium channel, nonvoltage-gated 1 beta
Synonyms: ENaC beta
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20277
Homologene: 133555
Parp14
Name: poly (ADP-ribose) polymerase family, member 14
Synonyms: CoaSt6, 1600029O10Rik, collaborator of Stat6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 547253
Homologene: 19697
Gpr180
Name: G protein-coupled receptor 180
Synonyms: ITR, E130016I23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 58245
VEGA: 14
Homologene: 32506
Apbb1ip
Name: amyloid beta precursor protein binding family B member 1 interacting protein
Synonyms: proline-rich protein 48, Prp48, 9930118P07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 54519
Homologene: 32434
Thnsl2
Name: threonine synthase-like 2 (bacterial)
Synonyms: TSH2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232078
Homologene: 5489
Abhd10
Name: abhydrolase domain containing 10
Synonyms: D230019K24Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 213012
Homologene: 10173
Mdp1
Name: magnesium-dependent phosphatase 1
Synonyms: 1810034K20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67881
VEGA: 14
Homologene: 5846
Vmn2r86
Name: vomeronasal 2, receptor 86
Synonyms: EG625109
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625109
Homologene: 129606
Endov
Name: endonuclease V
Synonyms: A730011L01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 338371
Homologene: 15562
Dus4l
Name: dihydrouridine synthase 4 like
Synonyms: 2700089B10Rik, 2310069P03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71916
VEGA: 12
Homologene: 6535
Selenoi
Name: selenoprotein I
Synonyms: D5Wsu178e, Ept1, 4933402G07Rik, C79563
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 28042
Homologene: 100935
Nt5c3b
Name: 5'-nucleotidase, cytosolic IIIB
Synonyms: Nt5c3l, C330027I04Rik, 2610037D24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68106
Homologene: 41684
Tmem156
Name: transmembrane protein 156
Synonyms: LOC243025
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243025
Homologene: 49811
Or2y1b
Name: olfactory receptor family 2 subfamily Y member 1B
Synonyms: L45, GA_x6K02T2QP88-6117098-6116163, Olfr10, MOR256-55
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18307
Homologene: 81347
Cnfn
Name: cornifelin
Synonyms: 2210418J09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72383
Homologene: 13039
Slc36a3
Name: solute carrier family 36 (proton/amino acid symporter), member 3
Synonyms: PAT3, tramdorin2, TRAMD2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 215332
Homologene: 76175
Ch25h
Name: cholesterol 25-hydroxylase
Synonyms: m25OH
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12642
VEGA: 19
HGNC: HGNC:1907
Homologene: 2942
Mpi
Name: mannose phosphate isomerase
Synonyms: 1110002E17Rik, Mpi-1, Mpi1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110119
HGNC: HGNC:7216
Homologene: 1825
Or8b9
Name: olfactory receptor family 8 subfamily B member 9
Synonyms: Olfr877, GA_x6K02T2PVTD-31540342-31541277, MOR161-5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258412
Homologene: 121556
Or52e5
Name: olfactory receptor family 52 subfamily E member 5
Synonyms: GA_x6K02T2PBJ9-7698491-7699432, Olfr678, MOR32-5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258753
Homologene: 27254
Asb16
Name: ankyrin repeat and SOCS box-containing 16
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217217
Homologene: 76813
1700001O22Rik
Name: RIKEN cDNA 1700001O22 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 73598
Homologene: 18859
Btbd18
Name: BTB domain containing 18
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100270744
Homologene: 122125
Gm19965
Name: predicted gene, 19965
Type: Gene
Species: Mouse
Chromosome: 1
Gm13762
Name: predicted gene 13762
Type: Gene
Species: Mouse
Chromosome: 2
Gm11983
Name: predicted gene 11983
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 100418324
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 116,803,108 bp (GRCm38)
  • A to G, chromosome 1 at 116,821,480 bp (GRCm38)
  • A to T, chromosome 1 at 159,249,213 bp (GRCm38)
  • A to T, chromosome 1 at 180,669,168 bp (GRCm38)
  • A to T, chromosome 2 at 22,835,977 bp (GRCm38)
  • A to G, chromosome 2 at 25,660,130 bp (GRCm38)
  • T to C, chromosome 2 at 30,801,244 bp (GRCm38)
  • T to A, chromosome 2 at 84,667,510 bp (GRCm38)
  • T to G, chromosome 2 at 88,973,271 bp (GRCm38)
  • T to C, chromosome 2 at 103,725,695 bp (GRCm38)
  • T to A, chromosome 2 at 144,586,423 bp (GRCm38)
  • A to T, chromosome 4 at 3,575,071 bp (GRCm38)
  • A to G, chromosome 4 at 46,016,888 bp (GRCm38)
  • A to G, chromosome 4 at 141,320,523 bp (GRCm38)
  • C to A, chromosome 4 at 148,261,154 bp (GRCm38)
  • A to G, chromosome 4 at 148,565,247 bp (GRCm38)
  • A to G, chromosome 5 at 16,572,536 bp (GRCm38)
  • C to T, chromosome 5 at 20,465,866 bp (GRCm38)
  • T to C, chromosome 5 at 28,074,548 bp (GRCm38)
  • T to C, chromosome 5 at 30,248,415 bp (GRCm38)
  • A to G, chromosome 5 at 65,073,804 bp (GRCm38)
  • T to A, chromosome 6 at 3,375,078 bp (GRCm38)
  • CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC to CATC, chromosome 6 at 4,756,431 bp (GRCm38)
  • T to G, chromosome 6 at 71,131,946 bp (GRCm38)
  • T to G, chromosome 7 at 16,996,162 bp (GRCm38)
  • G to T, chromosome 7 at 25,368,090 bp (GRCm38)
  • T to C, chromosome 7 at 26,575,608 bp (GRCm38)
  • T to C, chromosome 7 at 37,965,313 bp (GRCm38)
  • T to A, chromosome 7 at 44,880,100 bp (GRCm38)
  • T to A, chromosome 7 at 105,070,076 bp (GRCm38)
  • A to T, chromosome 7 at 120,289,511 bp (GRCm38)
  • A to T, chromosome 7 at 121,899,239 bp (GRCm38)
  • A to G, chromosome 8 at 40,796,596 bp (GRCm38)
  • A to T, chromosome 8 at 71,629,553 bp (GRCm38)
  • C to A, chromosome 8 at 94,828,437 bp (GRCm38)
  • T to C, chromosome 8 at 120,229,541 bp (GRCm38)
  • G to A, chromosome 9 at 37,855,375 bp (GRCm38)
  • T to C, chromosome 9 at 57,545,256 bp (GRCm38)
  • A to G, chromosome 9 at 86,586,994 bp (GRCm38)
  • T to A, chromosome 10 at 5,347,847 bp (GRCm38)
  • T to A, chromosome 10 at 130,449,833 bp (GRCm38)
  • T to C, chromosome 11 at 6,339,209 bp (GRCm38)
  • T to A, chromosome 11 at 6,837,020 bp (GRCm38)
  • A to T, chromosome 11 at 9,056,438 bp (GRCm38)
  • A to G, chromosome 11 at 49,317,563 bp (GRCm38)
  • A to T, chromosome 11 at 55,135,335 bp (GRCm38)
  • A to G, chromosome 11 at 70,923,203 bp (GRCm38)
  • A to G, chromosome 11 at 93,932,392 bp (GRCm38)
  • A to G, chromosome 11 at 98,170,946 bp (GRCm38)
  • A to T, chromosome 11 at 100,432,985 bp (GRCm38)
  • A to T, chromosome 11 at 102,268,940 bp (GRCm38)
  • A to G, chromosome 11 at 103,195,471 bp (GRCm38)
  • G to A, chromosome 11 at 119,468,980 bp (GRCm38)
  • C to T, chromosome 11 at 119,507,222 bp (GRCm38)
  • T to A, chromosome 12 at 3,256,947 bp (GRCm38)
  • A to T, chromosome 12 at 31,646,648 bp (GRCm38)
  • T to A, chromosome 12 at 51,629,503 bp (GRCm38)
  • A to G, chromosome 12 at 71,944,373 bp (GRCm38)
  • A to G, chromosome 13 at 46,289,748 bp (GRCm38)
  • C to A, chromosome 13 at 65,073,600 bp (GRCm38)
  • C to T, chromosome 14 at 47,310,883 bp (GRCm38)
  • A to G, chromosome 14 at 55,659,247 bp (GRCm38)
  • G to A, chromosome 14 at 118,153,890 bp (GRCm38)
  • C to A, chromosome 15 at 35,674,887 bp (GRCm38)
  • T to C, chromosome 15 at 39,138,101 bp (GRCm38)
  • A to G, chromosome 15 at 82,065,496 bp (GRCm38)
  • A to T, chromosome 15 at 101,707,706 bp (GRCm38)
  • A to T, chromosome 16 at 13,132,946 bp (GRCm38)
  • A to G, chromosome 16 at 20,286,940 bp (GRCm38)
  • T to C, chromosome 16 at 32,753,284 bp (GRCm38)
  • T to C, chromosome 16 at 35,840,881 bp (GRCm38)
  • G to T, chromosome 16 at 35,840,882 bp (GRCm38)
  • T to C, chromosome 16 at 45,731,679 bp (GRCm38)
  • A to T, chromosome 16 at 56,024,504 bp (GRCm38)
  • T to A, chromosome 16 at 90,247,234 bp (GRCm38)
  • T to C, chromosome 17 at 25,383,241 bp (GRCm38)
  • A to C, chromosome 17 at 74,217,046 bp (GRCm38)
  • T to A, chromosome 17 at 74,640,297 bp (GRCm38)
  • T to A, chromosome 18 at 37,490,553 bp (GRCm38)
  • T to C, chromosome 18 at 37,979,852 bp (GRCm38)
  • A to T, chromosome 18 at 52,905,843 bp (GRCm38)
  • A to T, chromosome 18 at 77,759,502 bp (GRCm38)
  • G to A, chromosome 19 at 34,474,547 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9696 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069489-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.