Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9696Btlr/Mmmh
Stock Number:
069489-MU
Citation ID:
RRID:MMRRC_069489-MU
Other Names:
R9696 (G1)
Major Collection:

Strain Information

Epha2
Name: Eph receptor A2
Synonyms: Sek-2, Eck, Sek2, Myk2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13836
HGNC: HGNC:3386
Homologene: 20929
Krt5
Name: keratin 5
Synonyms: 3300001P10Rik, Tfip8, K5, Krt2-5
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110308
HGNC: HGNC:6442
Homologene: 55461
Cacna1h
Name: calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms: alpha13.2, Cav3.2, T-type Cav3.2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 58226
HGNC: HGNC:1395
Homologene: 56913
Hgf
Name: hepatocyte growth factor
Synonyms: scatter factor, NK1, SF/HGF, HGF/SF, NK2, C230052L06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15234
HGNC: HGNC:4893
Homologene: 503
Med1
Name: mediator complex subunit 1
Synonyms: TRAP 220, TRAP220, CRSP210, DRIP205, Pparbp, l11Jus15, PBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Uri1
Name: URI1, prefoldin-like chaperone
Synonyms: NNX3, Rmp, C80913
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19777
Homologene: 2813
Ciapin1
Name: cytokine induced apoptosis inhibitor 1
Synonyms: anamorsin, 2810413N20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109006
Homologene: 10658
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 116,803,108 bp (GRCm38)
  • A to G, chromosome 1 at 116,821,480 bp (GRCm38)
  • A to T, chromosome 1 at 159,249,213 bp (GRCm38)
  • A to T, chromosome 1 at 180,669,168 bp (GRCm38)
  • A to T, chromosome 2 at 22,835,977 bp (GRCm38)
  • A to G, chromosome 2 at 25,660,130 bp (GRCm38)
  • T to C, chromosome 2 at 30,801,244 bp (GRCm38)
  • T to A, chromosome 2 at 84,667,510 bp (GRCm38)
  • T to G, chromosome 2 at 88,973,271 bp (GRCm38)
  • T to C, chromosome 2 at 103,725,695 bp (GRCm38)
  • T to A, chromosome 2 at 144,586,423 bp (GRCm38)
  • A to T, chromosome 4 at 3,575,071 bp (GRCm38)
  • A to G, chromosome 4 at 46,016,888 bp (GRCm38)
  • A to G, chromosome 4 at 141,320,523 bp (GRCm38)
  • C to A, chromosome 4 at 148,261,154 bp (GRCm38)
  • A to G, chromosome 4 at 148,565,247 bp (GRCm38)
  • A to G, chromosome 5 at 16,572,536 bp (GRCm38)
  • C to T, chromosome 5 at 20,465,866 bp (GRCm38)
  • T to C, chromosome 5 at 28,074,548 bp (GRCm38)
  • T to C, chromosome 5 at 30,248,415 bp (GRCm38)
  • A to G, chromosome 5 at 65,073,804 bp (GRCm38)
  • T to A, chromosome 6 at 3,375,078 bp (GRCm38)
  • CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC to CATC, chromosome 6 at 4,756,431 bp (GRCm38)
  • T to G, chromosome 6 at 71,131,946 bp (GRCm38)
  • T to G, chromosome 7 at 16,996,162 bp (GRCm38)
  • G to T, chromosome 7 at 25,368,090 bp (GRCm38)
  • T to C, chromosome 7 at 26,575,608 bp (GRCm38)
  • T to C, chromosome 7 at 37,965,313 bp (GRCm38)
  • T to A, chromosome 7 at 44,880,100 bp (GRCm38)
  • T to A, chromosome 7 at 105,070,076 bp (GRCm38)
  • A to T, chromosome 7 at 120,289,511 bp (GRCm38)
  • A to T, chromosome 7 at 121,899,239 bp (GRCm38)
  • A to G, chromosome 8 at 40,796,596 bp (GRCm38)
  • A to T, chromosome 8 at 71,629,553 bp (GRCm38)
  • C to A, chromosome 8 at 94,828,437 bp (GRCm38)
  • T to C, chromosome 8 at 120,229,541 bp (GRCm38)
  • G to A, chromosome 9 at 37,855,375 bp (GRCm38)
  • T to C, chromosome 9 at 57,545,256 bp (GRCm38)
  • A to G, chromosome 9 at 86,586,994 bp (GRCm38)
  • T to A, chromosome 10 at 5,347,847 bp (GRCm38)
  • T to A, chromosome 10 at 130,449,833 bp (GRCm38)
  • T to C, chromosome 11 at 6,339,209 bp (GRCm38)
  • T to A, chromosome 11 at 6,837,020 bp (GRCm38)
  • A to T, chromosome 11 at 9,056,438 bp (GRCm38)
  • A to G, chromosome 11 at 49,317,563 bp (GRCm38)
  • A to T, chromosome 11 at 55,135,335 bp (GRCm38)
  • A to G, chromosome 11 at 70,923,203 bp (GRCm38)
  • A to G, chromosome 11 at 93,932,392 bp (GRCm38)
  • A to G, chromosome 11 at 98,170,946 bp (GRCm38)
  • A to T, chromosome 11 at 100,432,985 bp (GRCm38)
  • A to T, chromosome 11 at 102,268,940 bp (GRCm38)
  • A to G, chromosome 11 at 103,195,471 bp (GRCm38)
  • G to A, chromosome 11 at 119,468,980 bp (GRCm38)
  • C to T, chromosome 11 at 119,507,222 bp (GRCm38)
  • T to A, chromosome 12 at 3,256,947 bp (GRCm38)
  • A to T, chromosome 12 at 31,646,648 bp (GRCm38)
  • T to A, chromosome 12 at 51,629,503 bp (GRCm38)
  • A to G, chromosome 12 at 71,944,373 bp (GRCm38)
  • A to G, chromosome 13 at 46,289,748 bp (GRCm38)
  • C to A, chromosome 13 at 65,073,600 bp (GRCm38)
  • C to T, chromosome 14 at 47,310,883 bp (GRCm38)
  • A to G, chromosome 14 at 55,659,247 bp (GRCm38)
  • G to A, chromosome 14 at 118,153,890 bp (GRCm38)
  • C to A, chromosome 15 at 35,674,887 bp (GRCm38)
  • T to C, chromosome 15 at 39,138,101 bp (GRCm38)
  • A to G, chromosome 15 at 82,065,496 bp (GRCm38)
  • A to T, chromosome 15 at 101,707,706 bp (GRCm38)
  • A to T, chromosome 16 at 13,132,946 bp (GRCm38)
  • A to G, chromosome 16 at 20,286,940 bp (GRCm38)
  • T to C, chromosome 16 at 32,753,284 bp (GRCm38)
  • T to C, chromosome 16 at 35,840,881 bp (GRCm38)
  • G to T, chromosome 16 at 35,840,882 bp (GRCm38)
  • T to C, chromosome 16 at 45,731,679 bp (GRCm38)
  • A to T, chromosome 16 at 56,024,504 bp (GRCm38)
  • T to A, chromosome 16 at 90,247,234 bp (GRCm38)
  • T to C, chromosome 17 at 25,383,241 bp (GRCm38)
  • A to C, chromosome 17 at 74,217,046 bp (GRCm38)
  • T to A, chromosome 17 at 74,640,297 bp (GRCm38)
  • T to A, chromosome 18 at 37,490,553 bp (GRCm38)
  • T to C, chromosome 18 at 37,979,852 bp (GRCm38)
  • A to T, chromosome 18 at 52,905,843 bp (GRCm38)
  • A to T, chromosome 18 at 77,759,502 bp (GRCm38)
  • G to A, chromosome 19 at 34,474,547 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9696 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069489-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.