Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9697Btlr/Mmmh
Stock Number:
069490-MU
Citation ID:
RRID:MMRRC_069490-MU
Other Names:
R9697 (G1)
Major Collection:

Strain Information

Ltbp3
Name: latent transforming growth factor beta binding protein 3
Synonyms: Ltbp2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16998
VEGA: 19
HGNC: HGNC:6716
Homologene: 7405
Tlr9
Name: toll-like receptor 9
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 81897
Homologene: 68126
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Uhrf2
Name: ubiquitin-like, containing PHD and RING finger domains 2
Synonyms: 2310065A22Rik, Nirf, D130071B19Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 109113
Homologene: 17001
Bet1
Name: Bet1 golgi vesicular membrane trafficking protein
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12068
Homologene: 38108
Cntnap1
Name: contactin associated protein-like 1
Synonyms: p190, Caspr, Nrxn4, NCP1, paranodin, shm
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53321
HGNC: HGNC:8011
Homologene: 2693
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 97,785,172 bp (GRCm38)
  • T to C, chromosome 2 at 5,914,840 bp (GRCm38)
  • T to A, chromosome 2 at 25,372,913 bp (GRCm38)
  • T to A, chromosome 2 at 110,665,908 bp (GRCm38)
  • G to A, chromosome 2 at 180,999,784 bp (GRCm38)
  • T to C, chromosome 3 at 25,439,871 bp (GRCm38)
  • A to G, chromosome 3 at 89,877,912 bp (GRCm38)
  • A to G, chromosome 3 at 104,049,142 bp (GRCm38)
  • G to A, chromosome 4 at 114,908,487 bp (GRCm38)
  • T to C, chromosome 4 at 115,021,504 bp (GRCm38)
  • A to G, chromosome 4 at 138,314,012 bp (GRCm38)
  • A to G, chromosome 4 at 141,468,964 bp (GRCm38)
  • G to A, chromosome 4 at 155,772,879 bp (GRCm38)
  • A to G, chromosome 5 at 5,626,041 bp (GRCm38)
  • A to T, chromosome 5 at 88,318,567 bp (GRCm38)
  • A to T, chromosome 5 at 93,202,342 bp (GRCm38)
  • G to A, chromosome 5 at 108,473,907 bp (GRCm38)
  • A to G, chromosome 5 at 114,633,224 bp (GRCm38)
  • A to G, chromosome 5 at 130,212,940 bp (GRCm38)
  • A to T, chromosome 5 at 146,094,380 bp (GRCm38)
  • G to A, chromosome 6 at 4,082,471 bp (GRCm38)
  • A to T, chromosome 6 at 7,689,268 bp (GRCm38)
  • C to T, chromosome 6 at 41,354,107 bp (GRCm38)
  • A to G, chromosome 6 at 118,612,637 bp (GRCm38)
  • T to G, chromosome 6 at 137,386,290 bp (GRCm38)
  • G to A, chromosome 6 at 139,967,791 bp (GRCm38)
  • T to C, chromosome 7 at 5,883,860 bp (GRCm38)
  • A to G, chromosome 7 at 28,310,925 bp (GRCm38)
  • GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA to GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA, chromosome 7 at 30,752,966 bp (GRCm38)
  • TCCCAGG to T, chromosome 7 at 80,098,331 bp (GRCm38)
  • A to G, chromosome 7 at 102,428,807 bp (GRCm38)
  • G to A, chromosome 7 at 104,841,288 bp (GRCm38)
  • A to G, chromosome 8 at 11,437,628 bp (GRCm38)
  • A to G, chromosome 8 at 60,919,484 bp (GRCm38)
  • G to A, chromosome 8 at 70,811,230 bp (GRCm38)
  • G to T, chromosome 8 at 91,260,763 bp (GRCm38)
  • G to A, chromosome 8 at 111,348,027 bp (GRCm38)
  • C to T, chromosome 9 at 106,223,524 bp (GRCm38)
  • T to C, chromosome 9 at 108,561,648 bp (GRCm38)
  • T to G, chromosome 10 at 41,422,972 bp (GRCm38)
  • T to C, chromosome 10 at 92,956,989 bp (GRCm38)
  • A to T, chromosome 11 at 34,254,417 bp (GRCm38)
  • A to G, chromosome 11 at 68,277,530 bp (GRCm38)
  • T to A, chromosome 11 at 90,276,753 bp (GRCm38)
  • T to C, chromosome 11 at 101,178,002 bp (GRCm38)
  • A to T, chromosome 13 at 21,115,722 bp (GRCm38)
  • T to C, chromosome 13 at 54,719,866 bp (GRCm38)
  • T to C, chromosome 14 at 51,195,869 bp (GRCm38)
  • G to A, chromosome 14 at 118,153,890 bp (GRCm38)
  • C to T, chromosome 15 at 40,142,104 bp (GRCm38)
  • A to T, chromosome 15 at 75,676,025 bp (GRCm38)
  • A to T, chromosome 16 at 18,280,419 bp (GRCm38)
  • C to T, chromosome 17 at 14,943,507 bp (GRCm38)
  • T to A, chromosome 17 at 36,189,852 bp (GRCm38)
  • T to C, chromosome 17 at 43,314,471 bp (GRCm38)
  • T to A, chromosome 17 at 94,727,378 bp (GRCm38)
  • T to C, chromosome 18 at 12,751,350 bp (GRCm38)
  • T to C, chromosome 18 at 38,281,969 bp (GRCm38)
  • C to A, chromosome 18 at 58,968,762 bp (GRCm38)
  • T to A, chromosome 19 at 5,742,493 bp (GRCm38)
  • G to A, chromosome 19 at 13,165,524 bp (GRCm38)
  • A to G, chromosome 19 at 30,086,380 bp (GRCm38)
  • A to T, chromosome 19 at 46,719,981 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9697 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069490-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.