Register New MMRRC Account
Reset Password
Register for New Mouse Models
Click Here for Additional Contact Information
Availability & Fees Order this Strain
The Kif1aem8Lutzy (Kif1a cKO) allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing at The Jackson Laboratory. Guide RNAs (GTGAGTCCATCCCAATGAGA, CTTTGCCCCTCTCATTGGGA, ACTCTGCCCTAATCACCTGA, and TCAACTCAGAGTGACCCTTC) were selected to target exon 3 of the kinesin family member 1A on Chromosome 1. Donor DNAs including loxP sites were created 160 bp upstream of exon 3 and 120 bp downstream of exon 3. LoxP insertion sites are separated by 363bp. Kif1a transcript Kif1a-204 was used as a reference for the exon numbering and the guide/donor sequences.
The Kif1a (kinesin family member 1A ) gene encodes an anterograde motor protein that is involved in organelle trafficking. Mutations in this gene have been associated with autosomal dominant 9 mental retardation; neuropathy, hereditary sensory, type IIC, autosomal recessive spastic paraplegia 30, and KIF1A-associated neurological disorder (KAND).
Prior to Cre recombinase exposure, mice heterozygous or homozygous for this floxed allele are viable and fertile, with no reported phenotypic abnormalities. No alterations of endogenous gene expression were observed. Upon exposure to Cre recombinase, deletion of the floxed sequences results in a null allele.
Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.
Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.
1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.
3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.
4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
We use cookies to improve your experience, personalize content, and analyze traffic. By using this site, you agree to our use of cookies. For more details, please visit our Privacy Policy.