Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9727Btlr/Mmmh
Stock Number:
069973-MU
Citation ID:
RRID:MMRRC_069973-MU
Other Names:
R9727 (G1)
Major Collection:

Strain Information

Smarca4
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Synonyms: SNF2beta, Brg1, SW1/SNF, b2b692Clo, b2b508.1Clo
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20586
Homologene: 135927
Nos2
Name: nitric oxide synthase 2, inducible
Synonyms: iNOS, Nos-2, NOS-II, Nos2a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18126
HGNC: HGNC:7873
Homologene: 55473
Lgals8
Name: lectin, galactose binding, soluble 8
Synonyms: Lgals-8, 1200015E08Rik, D13Ertd524e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56048
HGNC: HGNC:6569
Homologene: 31386
Ccn2
Name: cellular communication network factor 2
Synonyms: Hcs24, hypertrophic chondrocyte-specific gene product 24, Fisp12, Ccn2, Ctgf
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14219
HGNC: HGNC:2500
Homologene: 1431
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Sipa1l1
Name: signal-induced proliferation-associated 1 like 1
Synonyms: 4931426N11Rik, Spar
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217692
VEGA: 12
Homologene: 9189
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: CD221, IGF-1R, line 186, hyft, A330103N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to A, chromosome 1 at 34,275,796 bp (GRCm38)
  • A to G, chromosome 1 at 45,376,658 bp (GRCm38)
  • A to G, chromosome 1 at 58,247,314 bp (GRCm38)
  • G to A, chromosome 1 at 87,503,288 bp (GRCm38)
  • T to C, chromosome 1 at 150,798,815 bp (GRCm38)
  • T to A, chromosome 1 at 172,291,369 bp (GRCm38)
  • A to G, chromosome 2 at 26,281,192 bp (GRCm38)
  • T to A, chromosome 2 at 32,775,842 bp (GRCm38)
  • C to A, chromosome 2 at 33,411,521 bp (GRCm38)
  • C to T, chromosome 2 at 109,288,119 bp (GRCm38)
  • A to T, chromosome 2 at 111,231,616 bp (GRCm38)
  • C to A, chromosome 2 at 119,138,346 bp (GRCm38)
  • G to A, chromosome 2 at 122,286,517 bp (GRCm38)
  • T to C, chromosome 2 at 127,810,689 bp (GRCm38)
  • G to A, chromosome 2 at 145,860,586 bp (GRCm38)
  • T to A, chromosome 2 at 157,020,248 bp (GRCm38)
  • A to G, chromosome 4 at 34,565,248 bp (GRCm38)
  • T to A, chromosome 4 at 63,167,741 bp (GRCm38)
  • T to C, chromosome 4 at 91,281,258 bp (GRCm38)
  • G to T, chromosome 4 at 98,987,331 bp (GRCm38)
  • A to G, chromosome 4 at 107,193,350 bp (GRCm38)
  • T to A, chromosome 4 at 139,413,424 bp (GRCm38)
  • T to A, chromosome 5 at 87,140,306 bp (GRCm38)
  • T to A, chromosome 5 at 135,121,534 bp (GRCm38)
  • A to T, chromosome 6 at 71,592,110 bp (GRCm38)
  • A to G, chromosome 6 at 89,674,769 bp (GRCm38)
  • G to T, chromosome 6 at 135,381,018 bp (GRCm38)
  • C to A, chromosome 7 at 17,158,337 bp (GRCm38)
  • T to C, chromosome 7 at 27,703,700 bp (GRCm38)
  • T to A, chromosome 7 at 68,207,806 bp (GRCm38)
  • A to T, chromosome 7 at 126,995,868 bp (GRCm38)
  • A to G, chromosome 8 at 121,886,346 bp (GRCm38)
  • T to C, chromosome 8 at 123,845,430 bp (GRCm38)
  • T to C, chromosome 9 at 21,699,864 bp (GRCm38)
  • A to T, chromosome 9 at 53,376,402 bp (GRCm38)
  • T to A, chromosome 9 at 88,569,860 bp (GRCm38)
  • A to T, chromosome 9 at 100,474,948 bp (GRCm38)
  • A to G, chromosome 10 at 24,595,922 bp (GRCm38)
  • T to C, chromosome 10 at 80,792,548 bp (GRCm38)
  • A to G, chromosome 11 at 55,268,311 bp (GRCm38)
  • A to C, chromosome 11 at 73,239,521 bp (GRCm38)
  • A to G, chromosome 11 at 78,952,999 bp (GRCm38)
  • T to A, chromosome 11 at 99,948,514 bp (GRCm38)
  • CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG to CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG, chromosome 11 at 115,012,431 bp (GRCm38)
  • T to G, chromosome 11 at 115,355,113 bp (GRCm38)
  • C to A, chromosome 12 at 80,759,270 bp (GRCm38)
  • T to C, chromosome 12 at 82,425,055 bp (GRCm38)
  • A to T, chromosome 13 at 12,447,157 bp (GRCm38)
  • C to T, chromosome 14 at 26,801,553 bp (GRCm38)
  • A to G, chromosome 15 at 66,615,382 bp (GRCm38)
  • A to T, chromosome 15 at 71,977,274 bp (GRCm38)
  • T to A, chromosome 15 at 82,192,305 bp (GRCm38)
  • C to T, chromosome 15 at 99,273,788 bp (GRCm38)
  • C to T, chromosome 16 at 20,604,727 bp (GRCm38)
  • T to G, chromosome 16 at 29,409,771 bp (GRCm38)
  • A to T, chromosome 16 at 56,169,806 bp (GRCm38)
  • T to C, chromosome 17 at 31,499,071 bp (GRCm38)
  • A to C, chromosome 17 at 55,692,795 bp (GRCm38)
  • A to T, chromosome 17 at 57,011,005 bp (GRCm38)
  • A to G, chromosome 17 at 75,503,244 bp (GRCm38)
  • A to G, chromosome 17 at 80,371,291 bp (GRCm38)
  • A to T, chromosome 17 at 81,038,156 bp (GRCm38)
  • T to A, chromosome 19 at 8,131,454 bp (GRCm38)
  • A to T, chromosome 19 at 29,597,858 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9727 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069973-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.