Strain Name:
C57BL/6J-MtgxR0105Btlr/Mmmh
Stock Number:
038391-MU
Citation ID:
RRID:MMRRC_038391-MU
Other Names:
R0105 (G1), C57BL/6J-MtgxR0105Btlr
Major Collection:

Strain Information

Elavl3
Name: ELAV like RNA binding protein 3
Synonyms: mHuC, Huc, 2600009P04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15571
VEGA: 9
HGNC: HGNC:3314
Homologene: 31035
Neurog1
Name: neurogenin 1
Synonyms: neurogenin, Math4C, ngn1, neurogenin 1, Neurod3, bHLHa6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18014
VEGA: 13
HGNC: HGNC:7764
Homologene: 4490
Adcy9
Name: adenylate cyclase 9
Synonyms: D16Wsu65e, ACtp10
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11515
HGNC: HGNC:240
Homologene: 868
Cr1l
Name: complement C3b/C4b receptor 1 like
Synonyms: mCRY, Crry
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12946
Homologene: 128275
Ptdss2
Name: phosphatidylserine synthase 2
Synonyms: PSS2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27388
Homologene: 8462
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Prrc2b
Name: proline-rich coiled-coil 2B
Synonyms: 5830434P21Rik, Bat2l
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227723
Homologene: 106649
Ctdspl2
Name: CTD small phosphatase like 2
Synonyms: D2Ertd485e, SCP4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329506
Homologene: 32311
Zcchc17
Name: zinc finger, CCHC domain containing 17
Synonyms: HSPC251, Ps1d, 2810055E05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 619605
Homologene: 32319
Cog3
Name: component of oligomeric golgi complex 3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 338337
VEGA: 14
Homologene: 5854
Fto
Name: FTO alpha-ketoglutarate dependent dioxygenase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26383
Homologene: 8053
Plekha5
Name: pleckstrin homology domain containing, family A member 5
Synonyms: PEPP2, 2810431N21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109135
Homologene: 10377
Isy1
Name: ISY1 splicing factor homolog
Synonyms: 5830446M03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 57905
Homologene: 6283
Tnfrsf21
Name: tumor necrosis factor receptor superfamily, member 21
Synonyms: DR6, Death receptor 6, TR7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 94185
VEGA: 17
Homologene: 8696
Mcm3ap
Name: minichromosome maintenance complex component 3 associated protein
Synonyms: GANP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 54387
VEGA: 10
HGNC: HGNC:6946
Homologene: 2902
Il15ra
Name: interleukin 15 receptor, alpha chain
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16169
HGNC: HGNC:5978
Homologene: 1650
Ppil4
Name: peptidylprolyl isomerase (cyclophilin)-like 4
Synonyms: PPIase, 3732410E19Rik, 3830425H19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67418
Homologene: 12126
Gab2
Name: growth factor receptor bound protein 2-associated protein 2
Synonyms: p97, D130058I17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14389
Homologene: 69067
Crmp1
Name: collapsin response mediator protein 1
Synonyms: Ulip3, DRP-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12933
HGNC: HGNC:2365
Homologene: 20347
Dsg2
Name: desmoglein 2
Synonyms: D18Ertd293e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13511
HGNC: HGNC:3049
Homologene: 1464
Treml2
Name: triggering receptor expressed on myeloid cells-like 2
Synonyms: LOC328833
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328833
VEGA: 17
Homologene: 81906
Ptpn4
Name: protein tyrosine phosphatase, non-receptor type 4
Synonyms: hPTP-MEG, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte), TEP/mPTPMEG, testis-enriched phosphatase, TEP, PTPMEG
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19258
HGNC: HGNC:9656
Homologene: 2120
Tbx10
Name: T-box 10
Synonyms: Tbx7, Tbx13
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 109575
VEGA: 19
Homologene: 37399
Reln
Name: reelin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19699
HGNC: HGNC:9957
Homologene: 3699
Atp6v0a4
Name: ATPase, H+ transporting, lysosomal V0 subunit A4
Synonyms: V-ATPase alpha 4, Atp6n1b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 140494
HGNC: HGNC:866
Homologene: 39904
Mroh7
Name: maestro heat-like repeat family member 7
Synonyms: LOC381538, Gm1027, Heatr8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381538
Homologene: 19633
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Tgm5
Name: transglutaminase 5
Synonyms: 2310007C07Rik, TGx
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74176
Homologene: 20899
Il1rl1
Name: interleukin 1 receptor-like 1
Synonyms: T1 gene, T1, ST2, T1/ST2, Fit-1, DER4, ST2L, St2, St2-rs1, Ly84
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17082
HGNC: HGNC:5998
Homologene: 2862
Slc35e1
Name: solute carrier family 35, member E1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270066
Homologene: 49075
Zhx2
Name: zinc fingers and homeoboxes 2
Synonyms: Raf, Afr-1, Afr1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 387609
Homologene: 8968
Plekhg4
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 4
Synonyms: 4931414L13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102075
Homologene: 18516
Cplane1
Name: ciliogenesis and planar polarity effector 1
Synonyms: b2b012Clo, Jbts17, Hug, 2410089E03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73692
Homologene: 11315
Slc22a29
Name: solute carrier family 22. member 29
Synonyms: D630002G06Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 236293
Homologene: 77136
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Psmb9
Name: proteasome (prosome, macropain) subunit, beta type 9 (large multifunctional peptidase 2)
Synonyms: Lmp-2, Lmp2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16912
HGNC: HGNC:9546
Homologene: 2094
Otog
Name: otogelin
Synonyms: Otgn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18419
HGNC: HGNC:8516
Homologene: 8421
Cdsn
Name: corneodesmosin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 386463
HGNC: HGNC:1802
Ddhd1
Name: DDHD domain containing 1
Synonyms: 9630061G18Rik, 4921528E07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 114874
Homologene: 35221
Gsdmc2
Name: gasdermin C2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 331063
HGNC: HGNC:7151
Homologene: 69487
Ankhd1
Name: ankyrin repeat and KH domain containing 1
Synonyms: 1110004O12Rik, 9130019P20Rik, 4933432B13Rik, A530027J04Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 108857
Homologene: 87006
Perm1
Name: PPARGC1 and ESRR induced regulator, muscle 1
Synonyms: 2310042D19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74183
Homologene: 135954
Mogat1
Name: monoacylglycerol O-acyltransferase 1
Synonyms: 0610030A14Rik, mDC2, MGAT1, Dgat2l1, 1110064N14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68393
Homologene: 105237
Cgnl1
Name: cingulin-like 1
Synonyms: Jacop, 4933421H10Rik, 9930020M10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68178
Homologene: 41901
5530400C23Rik
Name: RIKEN cDNA 5530400C23 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232426
Homologene: 79760
Pik3r5
Name: phosphoinositide-3-kinase regulatory subunit 5
Synonyms: Foap2, p101
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320207
Homologene: 8627
C1qtnf4
Name: C1q and tumor necrosis factor related protein 4
Synonyms: 0710001E10Rik, CTRP4, 9430004J15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67445
Homologene: 12134
Sdcbp2
Name: syndecan binding protein (syntenin) 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228765
Homologene: 9240
Gm973
Name: predicted gene 973
Synonyms: LOC381260
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381260
Homologene: 124277
Fam20b
Name: FAM20B, glycosaminoglycan xylosylkinase
Synonyms: C530043G21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215015
Homologene: 8909
Pla2r1
Name: phospholipase A2 receptor 1
Synonyms: PLA2-I receptor, M-type receptor, Pla2g1br
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18779
HGNC: HGNC:9042
Homologene: 32016
Or4c105
Name: olfactory receptor family 4 subfamily C member 105
Synonyms: GA_x6K02T2Q125-50290367-50291296, MOR232-7, Olfr1202
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258454
Homologene: 133021
Or4a71
Name: olfactory receptor family 4 subfamily A member 71
Synonyms: GA_x6K02T2Q125-50972538-50971621, MOR231-4, Olfr1243
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258971
Homologene: 27317
Il6ra
Name: interleukin 6 receptor, alpha
Synonyms: IL-6 receptor alpha chain, CD126, Il6r, IL-6R
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16194
HGNC: HGNC:6019
Homologene: 474
Tex10
Name: testis expressed gene 10
Synonyms: clone 18330, 2810462N03Rik, 2610206N19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269536
Homologene: 32361
Sumf2
Name: sulfatase modifying factor 2
Synonyms: 2610040F05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67902
Homologene: 41037
A530053G22Rik
Name: RIKEN cDNA A530053G22 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 208079
C1s1
Name: complement component 1, s subcomponent 1
Synonyms: C1s
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50908
HGNC: HGNC:1247
Homologene: 1314
Nccrp1
Name: non-specific cytotoxic cell receptor protein 1 homolog (zebrafish)
Synonyms: LOC233038, 1190020J12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233038
Homologene: 19257
Lrrk1
Name: leucine-rich repeat kinase 1
Synonyms: D130026O16Rik, C230002E15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233328
Homologene: 23464
Lhpp
Name: phospholysine phosphohistidine inorganic pyrophosphate phosphatase
Synonyms: 2310007H09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76429
Homologene: 41469
Aldh8a1
Name: aldehyde dehydrogenase 8 family, member A1
Synonyms: RALDH4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237320
Homologene: 23369
Scml4
Name: Scm polycomb group protein like 4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268297
Homologene: 18262
Zkscan6
Name: zinc finger with KRAB and SCAN domains 6
Synonyms: 1700128E15Rik, KOX11, D11Ertd714e, Zfp535
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52712
Homologene: 12119
Trim65
Name: tripartite motif-containing 65
Synonyms: 4732463G12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 338364
Homologene: 27844
Fam227a
Name: family with sequence similarity 227, member A
Synonyms: 4933432B09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75729
Homologene: 123434
Krt76
Name: keratin 76
Synonyms: 2310001L23Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 77055
Homologene: 22931
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 20,523,732 bp
  • CTTGTTGTTGTTGTTGTTG to CTTGTTGTTGTTGTTGTTGTTG, chromosome 1 at 40,442,574 bp
  • A to G, chromosome 1 at 59,582,474 bp
  • A to G, chromosome 1 at 78,523,670 bp
  • A to G, chromosome 1 at 90,798,161 bp
  • C to T, chromosome 1 at 119,687,605 bp
  • T to C, chromosome 1 at 156,690,570 bp
  • A to G, chromosome 1 at 195,112,412 bp
  • T to A, chromosome 2 at 11,730,648 bp
  • G to T, chromosome 2 at 32,213,311 bp
  • T to C, chromosome 2 at 60,514,981 bp
  • T to A, chromosome 2 at 88,817,909 bp
  • T to C, chromosome 2 at 89,528,363 bp
  • T to A, chromosome 2 at 90,890,363 bp
  • C to A, chromosome 2 at 121,077,012 bp
  • T to A, chromosome 2 at 121,977,320 bp
  • A to T, chromosome 2 at 151,589,558 bp
  • A to G, chromosome 3 at 89,876,818 bp
  • C to A, chromosome 4 at 48,468,957 bp
  • T to C, chromosome 4 at 106,711,270 bp
  • T to A, chromosome 4 at 130,349,306 bp
  • T to C, chromosome 4 at 141,469,810 bp
  • C to A, chromosome 4 at 156,218,225 bp
  • G to A, chromosome 5 at 22,048,815 bp
  • T to A, chromosome 5 at 37,284,135 bp
  • T to A, chromosome 5 at 129,849,894 bp
  • T to C, chromosome 6 at 38,053,129 bp
  • T to C, chromosome 6 at 60,402,152 bp
  • C to T, chromosome 6 at 73,155,279 bp
  • G to A, chromosome 6 at 87,819,185 bp
  • T to C, chromosome 6 at 124,541,318 bp
  • G to A, chromosome 6 at 133,294,314 bp
  • G to A, chromosome 6 at 140,591,747 bp
  • T to C, chromosome 7 at 28,547,038 bp
  • C to A, chromosome 7 at 46,288,366 bp
  • G to T, chromosome 7 at 66,292,341 bp
  • T to C, chromosome 7 at 97,299,072 bp
  • T to C, chromosome 7 at 132,630,525 bp
  • T to C, chromosome 7 at 141,152,880 bp
  • T to C, chromosome 8 at 72,492,571 bp
  • G to A, chromosome 8 at 91,522,802 bp
  • G to A, chromosome 8 at 105,382,012 bp
  • C to A, chromosome 9 at 22,036,833 bp
  • T to C, chromosome 9 at 71,656,102 bp
  • A to G, chromosome 10 at 7,798,446 bp
  • T to A, chromosome 10 at 21,395,539 bp
  • T to A, chromosome 10 at 42,930,599 bp
  • T to A, chromosome 10 at 76,499,534 bp
  • T to A, chromosome 11 at 65,821,985 bp
  • A to T, chromosome 11 at 68,490,511 bp
  • T to C, chromosome 11 at 116,126,066 bp
  • G to T, chromosome 13 at 56,251,237 bp
  • T to C, chromosome 14 at 45,610,690 bp
  • A to G, chromosome 14 at 75,722,140 bp
  • T to A, chromosome 15 at 8,187,392 bp
  • T to C, chromosome 15 at 57,822,695 bp
  • T to C, chromosome 15 at 63,828,177 bp
  • T to C, chromosome 15 at 79,620,832 bp
  • T to C, chromosome 15 at 101,884,912 bp
  • A to G, chromosome 16 at 4,288,388 bp
  • A to G, chromosome 17 at 34,187,275 bp
  • A to C, chromosome 17 at 35,556,138 bp
  • T to A, chromosome 17 at 43,040,191 bp
  • C to T, chromosome 17 at 48,302,828 bp
  • T to C, chromosome 18 at 20,602,054 bp
  • A to G, chromosome 18 at 36,646,766 bp
  • A to G, chromosome 19 at 3,993,121 bp
  • T to C, chromosome 19 at 8,160,627 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0105 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038391-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.