Strain Name:
C57BL/6J-MtgxR0370Btlr/Mmmh
Stock Number:
038576-MU
Citation ID:
RRID:MMRRC_038576-MU
Other Names:
R0370 (G1), C57BL/6J-MtgxR0370Btlr
Major Collection:

Strain Information

Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: 9930031C03Rik, brain spectrin, elf1, spectrin G, beta fodrin, Spnb2, non-erythrocytic, Spnb-2, elf3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Kdm4c
Name: lysine (K)-specific demethylase 4C
Synonyms: 2410141F18Rik, Jmjd2c
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76804
Homologene: 41004
Tns3
Name: tensin 3
Synonyms: TEM6, F830010I22Rik, Tens1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319939
Homologene: 49713
Phf20
Name: PHD finger protein 20
Synonyms: 6820402O20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228829
Homologene: 9507
Dock6
Name: dedicator of cytokinesis 6
Synonyms: C330023D02Rik, 2410095B20Rik, 4931431C02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319899
VEGA: 9
Homologene: 83291
Med13l
Name: mediator complex subunit 13-like
Synonyms: 9030618F05Rik, Trap240L, Thrap2, 6330591G05Rik, 2210413I17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76199
Homologene: 25256
Ctdp1
Name: CTD phosphatase subunit 1
Synonyms: 4930563P03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67655
HGNC: HGNC:2498
Homologene: 31254
Lrp6
Name: low density lipoprotein receptor-related protein 6
Synonyms: skam26Jus, ska26, skax26, Cd
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16974
HGNC: HGNC:6698
Homologene: 1747
Dcc
Name: deleted in colorectal carcinoma
Synonyms: Igdcc1, C030036D22Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13176
HGNC: HGNC:2701
Homologene: 21081
Cand1
Name: cullin associated and neddylation disassociated 1
Synonyms: D10Ertd516e, 2310038O07Rik, 6330512O03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71902
Homologene: 10202
Rfx2
Name: regulatory factor X, 2 (influences HLA class II expression)
Synonyms: 5430432H19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19725
VEGA: 17
HGNC: HGNC:9983
Homologene: 30980
Dtl
Name: denticleless E3 ubiquitin protein ligase
Synonyms: 2810047L02Rik, 5730564G15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76843
Homologene: 32313
Paxip1
Name: PAX interacting (with transcription-activation domain) protein 1
Synonyms: D5Ertd149e, PTIP
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 55982
HGNC: HGNC:8624
Nol8
Name: nucleolar protein 8
Synonyms: 4921532D18Rik, 5730412B09Rik, D13Ertd548e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 70930
VEGA: 13
Homologene: 41210
Afg3l1
Name: AFG3-like AAA ATPase 1
Synonyms: 1700047G05Rik, 3110061K15Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 114896
HGNC: HGNC:314
Homologene: 134198
Sf3b2
Name: splicing factor 3b, subunit 2
Synonyms: 145kDa, SF3b145, SF3b1, B230398H18Rik, SF3b150, 2610311M13Rik, 2810441F20Rik, SAP145
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 319322
VEGA: 19
Homologene: 6678
Slc16a4
Name: solute carrier family 16 (monocarboxylic acid transporters), member 4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229699
Homologene: 74529
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Pico, Acz
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: b2b1203Clo, Dnahc11, avc4, b2b1289Clo, b2b1279Clo, lrd, b2b598Clo, b2b1727Clo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Or51k1
Name: olfactory receptor family 51 subfamily K member 1
Synonyms: Olfr639, MOR12-1, GA_x6K02T2PBJ9-6747143-6746193
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259088
Homologene: 17497
Tecta
Name: tectorin alpha
Synonyms: Tctna, [a]-tectorin
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21683
Homologene: 3955
2410017I17Rik
Name: RIKEN cDNA 2410017I17 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 675325
Il1rl1
Name: interleukin 1 receptor-like 1
Synonyms: St2-rs1, T1/ST2, T1 gene, ST2, Fit-1, DER4, ST2L, St2, T1, Ly84
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17082
HGNC: HGNC:5998
Homologene: 2862
Cyp2b9
Name: cytochrome P450, family 2, subfamily b, polypeptide 9
Synonyms: phenobarbitol inducible, type a, Cyp2b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13094
HGNC: HGNC:2615
Homologene: 74933
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Kcnn3
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Synonyms: SK3, small conductance calcium-activated potassium channel 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 140493
HGNC: HGNC:6292
Homologene: 20516
Carmil3
Name: capping protein regulator and myosin 1 linker 3
Synonyms: Lrrc16b
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268747
VEGA: 14
Homologene: 74564
Vmn2r59
Name: vomeronasal 2, receptor 59
Synonyms: EG628444
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 628444
Homologene: 129683
Slco2b1
Name: solute carrier organic anion transporter family, member 2b1
Synonyms: OATP-B, Slc21a9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101488
Homologene: 21419
Tmem94
Name: transmembrane protein 94
Synonyms: 2310067B10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71947
Homologene: 8831
Col22a1
Name: collagen, type XXII, alpha 1
Synonyms: C80743, 2310067L16Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69700
Homologene: 43567
Lmbrd2
Name: LMBR1 domain containing 2
Synonyms: 9930036E21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320506
VEGA: 15
Homologene: 44696
Samd9l
Name: sterile alpha motif domain containing 9-like
Synonyms: ESTM25
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 209086
HGNC: HGNC:1349
Homologene: 7707
Pkd1l2
Name: polycystic kidney disease 1 like 2
Synonyms: 1700126L06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76645
Homologene: 124481
Grid2
Name: glutamate receptor, ionotropic, delta 2
Synonyms: B230104L07Rik, GluRdelta2, tpr
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14804
HGNC: HGNC:4576
Homologene: 74399
Serpinb9d
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9d
Synonyms: ovalbumin, AT2, Spi9
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20726
HGNC: HGNC:8955
Homologene: 69093
Sec14l5
Name: SEC14-like lipid binding 5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 665119
VEGA: 16
Homologene: 96163
Mrrf
Name: mitochondrial ribosome recycling factor
Synonyms: 2400002D02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67871
HGNC: HGNC:7234
Homologene: 12203
Pkn3
Name: protein kinase N3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 263803
Homologene: 50980
Or8k3
Name: olfactory receptor family 8 subfamily K member 3
Synonyms: Olfr1047, GA_x6K02T2Q125-47703682-47702723, MOR188-3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259014
Homologene: 133664
Ugt2b36
Name: UDP glucuronosyltransferase 2 family, polypeptide B36
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231396
Homologene: 128251
Hoxa9
Name: homeobox A9
Synonyms: Hox-1.7, D6a9
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15405
HGNC: HGNC:5109
Homologene: 7766
Plekhg6
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 6
Synonyms: LOC213522
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213522
Homologene: 32395
Or13g1
Name: olfactory receptor family 13 subfamily G member 1
Synonyms: MOR251-4P, GA_x6K02T2NHDJ-9801340-9802266, Olfr309
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258196
Homologene: 47595
Defa26
Name: defensin, alpha, 26
Synonyms: Defcr26
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 626708
Homologene: 113382
B3gntl1
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
Synonyms: 6030413G23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 210004
Homologene: 14460
Ngly1
Name: N-glycanase 1
Synonyms: 1110002C09Rik, PNGase, Png1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 59007
Homologene: 10117
Setd4
Name: SET domain containing 4
Synonyms: ORF21
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224440
HGNC: HGNC:1258
Homologene: 41173
Mtmr1
Name: myotubularin related protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 53332
HGNC: HGNC:7449
Homologene: 2840
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • CTTGTTGTTGTTGTTGTTG to CTTGTTGTTGTTGTTGTTGTTG, chromosome 1 at 40,442,574 bp
  • G to T, chromosome 1 at 191,575,350 bp
  • T to A, chromosome 2 at 30,087,172 bp
  • A to T, chromosome 2 at 36,177,113 bp
  • A to T, chromosome 2 at 86,228,713 bp
  • GTGTTTGTTTGTTTGTTTGTTTGTTT to GTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTT, chromosome 2 at 156,287,770 bp
  • A to T, chromosome 3 at 89,667,092 bp
  • A to G, chromosome 3 at 107,301,097 bp
  • T to A, chromosome 4 at 74,373,558 bp
  • T to C, chromosome 5 at 14,521,090 bp
  • C to A, chromosome 5 at 27,760,086 bp
  • A to G, chromosome 5 at 87,091,975 bp
  • T to A, chromosome 5 at 118,741,826 bp
  • A to C, chromosome 6 at 3,377,264 bp
  • T to C, chromosome 6 at 52,225,704 bp
  • A to G, chromosome 6 at 64,345,734 bp
  • G to A, chromosome 6 at 125,370,660 bp
  • A to C, chromosome 6 at 134,479,766 bp
  • A to T, chromosome 7 at 26,210,106 bp
  • A to T, chromosome 7 at 42,012,726 bp
  • T to A, chromosome 7 at 86,306,849 bp
  • T to A, chromosome 7 at 99,690,437 bp
  • T to G, chromosome 7 at 104,012,059 bp
  • T to C, chromosome 7 at 120,086,720 bp
  • A to T, chromosome 8 at 21,618,859 bp
  • A to G, chromosome 8 at 117,044,629 bp
  • T to C, chromosome 8 at 123,501,554 bp
  • A to T, chromosome 9 at 21,814,565 bp
  • T to C, chromosome 9 at 42,366,804 bp
  • A to G, chromosome 10 at 119,206,826 bp
  • A to G, chromosome 11 at 8,445,730 bp
  • A to T, chromosome 11 at 30,121,545 bp
  • G to C, chromosome 11 at 115,788,717 bp
  • A to T, chromosome 11 at 121,624,154 bp
  • T to A, chromosome 12 at 117,995,227 bp
  • A to G, chromosome 13 at 33,195,966 bp
  • C to T, chromosome 13 at 49,662,447 bp
  • C to T, chromosome 14 at 16,294,685 bp
  • T to C, chromosome 14 at 47,664,075 bp
  • A to G, chromosome 14 at 55,495,442 bp
  • T to C, chromosome 15 at 9,165,852 bp
  • A to G, chromosome 15 at 71,811,037 bp
  • A to T, chromosome 16 at 5,180,706 bp
  • T to C, chromosome 16 at 93,591,118 bp
  • T to C, chromosome 17 at 36,161,592 bp
  • T to C, chromosome 17 at 56,799,308 bp
  • A to G, chromosome 18 at 71,587,985 bp
  • T to C, chromosome 18 at 80,449,354 bp
  • C to T, chromosome 19 at 5,274,824 bp
  • G to A, chromosome X at 71,388,231 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0370 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038576-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.