Strain Name:
C57BL/6J-MtgxR0374Btlr/Mmmh
Stock Number:
038580-MU
Citation ID:
RRID:MMRRC_038580-MU
Other Names:
R0374 (G1), C57BL/6J-MtgxR0374Btlr
Major Collection:

Strain Information

Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Drd2
Name: dopamine receptor D2
Synonyms: D2 receptor, D2R, Drd-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13489
VEGA: 9
HGNC: HGNC:3023
Homologene: 22561
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Foxm1
Name: forkhead box M1
Synonyms: Mpm2, WIN, HFH-11B, Trident, Fkh16, Foxm1b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14235
HGNC: HGNC:3818
Homologene: 7318
Prkd3
Name: protein kinase D3
Synonyms: 4930557O20Rik, 5730497N19Rik, PKD3, Prkcn
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75292
HGNC: HGNC:9408
Homologene: 2055
Scn3a
Name: sodium channel, voltage-gated, type III, alpha
Synonyms: LOC381367, Nav1.3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20269
Homologene: 56005
Ctbp2
Name: C-terminal binding protein 2
Synonyms: D7Ertd45e, Ribeye, Gtrgeo6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13017
HGNC: HGNC:2495
Homologene: 75187
Dusp1
Name: dual specificity phosphatase 1
Synonyms: mkp-1, erp, 3CH134, Ptpn16, MKP1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19252
HGNC: HGNC:3064
Homologene: 3254
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Dgka
Name: diacylglycerol kinase, alpha
Synonyms: Dagk1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13139
VEGA: 10
HGNC: HGNC:2849
Homologene: 1028
Zbtb7c
Name: zinc finger and BTB domain containing 7C
Synonyms: B230208J24Rik, Zbtb36, Kr-pok
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 207259
VEGA: 18
Homologene: 17070
Ptpra
Name: protein tyrosine phosphatase receptor type A
Synonyms: RPTRalpha, PTPalpha, PTP[a], Ptpa, RPTPalpha
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19262
HGNC: HGNC:9664
Homologene: 20621
Bbx
Name: bobby sox HMG box containing
Synonyms: 5730403O13Rik, 5530401J07Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70508
Homologene: 10634
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Specc1l
Name: sperm antigen with calponin homology and coiled-coil domains 1-like
Synonyms: 4930470P14Rik, 9530057A13Rik, 4932439K10Rik, Specc1l, Cytsa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74392
VEGA: 10
Homologene: 15610
Sap30bp
Name: SAP30 binding protein
Synonyms: 2700016D05Rik, Hcngp
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 57230
Homologene: 8308
Zc3h13
Name: zinc finger CCCH type containing 13
Synonyms: C87618, 4930570G11Rik, 2600010B19Rik, 3110050K21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67302
VEGA: 14
Pi4ka
Name: phosphatidylinositol 4-kinase alpha
Synonyms: Pik4ca
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224020
HGNC: HGNC:8983
Homologene: 11171
Nup205
Name: nucleoporin 205
Synonyms: 3830404O05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70699
Homologene: 45971
Setdb1
Name: SET domain, bifurcated 1
Synonyms: ESET, KMT1E
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 84505
Homologene: 32157
Ctdp1
Name: CTD phosphatase subunit 1
Synonyms: 4930563P03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67655
HGNC: HGNC:2498
Homologene: 31254
Wls
Name: wntless WNT ligand secretion mediator
Synonyms: 5031439A09Rik, Gpr177
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68151
Homologene: 11779
Nfs1
Name: nitrogen fixation gene 1 (S. cerevisiae)
Synonyms: m-Nfs1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18041
Homologene: 5463
Tcf4
Name: transcription factor 4
Synonyms: SEF-2, ITF-2, MITF-2B, MITF-2A, ME2, E2.2, TFE, E2-2, SEF2-1, ASP-I2, ITF-2b, 5730422P05Rik, bHLHb19
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 21413
Homologene: 2407
Aqr
Name: aquarius
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11834
Homologene: 7629
Fosb
Name: FBJ osteosarcoma oncogene B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14282
HGNC: HGNC:3797
Homologene: 31403
Casp9
Name: caspase 9
Synonyms: Mch6, ICE-LAP6, Caspase-9
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12371
HGNC: HGNC:1511
Homologene: 31024
Hr
Name: lysine demethylase and nuclear receptor corepressor
Synonyms: N, ba, rh, rh-bmh, bldy
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 15460
HGNC: HGNC:5172
Homologene: 3774
Lamc1
Name: laminin, gamma 1
Synonyms: Lamb2, laminin B2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226519
HGNC: HGNC:6492
Homologene: 1724
Rbm15
Name: RNA binding motif protein 15
Synonyms: C230088J01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229700
Homologene: 23383
Rbm10
Name: RNA binding motif protein 10
Synonyms: E430039K10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 236732
HGNC: HGNC:9896
Homologene: 31330
Prune2
Name: prune homolog 2
Synonyms: 6330414G02Rik, A330102H22Rik, A230083H22Rik, Olfaxin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
Sgk3
Name: serum/glucocorticoid regulated kinase 3
Synonyms: fy, cytokine-independent survival kinase, Cisk, 2510015P22Rik, A330005P07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170755
Homologene: 56582
Anxa6
Name: annexin A6
Synonyms: Camb, Anx6, AnxVI, Annexin VI, Cabm
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11749
HGNC: HGNC:544
Homologene: 55558
Map3k2
Name: mitogen-activated protein kinase kinase kinase 2
Synonyms: Mekk2, MEK kinase 2, 9630061B06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 26405
VEGA: 18
HGNC: HGNC:6854
Homologene: 74576
Nxf1
Name: nuclear RNA export factor 1
Synonyms: Tip associated protein, TAP, Mex67, Mvb1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 53319
HGNC: HGNC:8071
Homologene: 38176
Nol8
Name: nucleolar protein 8
Synonyms: 4921532D18Rik, D13Ertd548e, 5730412B09Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 70930
VEGA: 13
Homologene: 41210
Eea1
Name: early endosome antigen 1
Synonyms: B230358H09Rik, ZFYVE2, A430109M19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216238
VEGA: 10
HGNC: HGNC:3185
Homologene: 37822
Tbc1d2
Name: TBC1 domain family, member 2
Synonyms: LOC381605, PARIS-1, PARIS1, A630005A06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381605
Homologene: 10190
Ssh2
Name: slingshot protein phosphatase 2
Synonyms: SSH-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237860
Homologene: 14116
Slc9a2
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 2
Synonyms: NHE2, 4932415O19Rik, 2210416H12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226999
Homologene: 20661
Tmed2
Name: transmembrane p24 trafficking protein 2
Synonyms: Sid394, 1810020N21Rik, 1110032D12Rik, p24beta1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56334
Homologene: 55991
Cep192
Name: centrosomal protein 192
Synonyms: D430014P18Rik, 4631422C13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70799
VEGA: 18
Homologene: 73526
Pmpcb
Name: peptidase (mitochondrial processing) beta
Synonyms: MPPP52, MPP11, 3110004O18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73078
HGNC: HGNC:9119
Homologene: 3160
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Itpr2
Name: inositol 1,4,5-triphosphate receptor 2
Synonyms: Ip3r2, Itpr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16439
HGNC: HGNC:6181
Homologene: 37593
Pcdhac1
Name: protocadherin alpha subfamily C, 1
Synonyms: CNRc1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 353236
HGNC: HGNC:8676
Homologene: 49561
Scart2
Name: scavenger receptor family member expressed on T cells 2
Synonyms: 5830411N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244234
Homologene: 133218
Golga7b
Name: golgin A7B
Synonyms: 4933417O08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71146
Homologene: 28514
Mroh2a
Name: maestro heat-like repeat family member 2A
Synonyms: ENSMUSG00000044873, OTTMUSG00000020804, Heatr7b1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100040766
Homologene: 85300
Gbe1
Name: 1,4-alpha-glucan branching enzyme 1
Synonyms: 2310045H19Rik, 2810426P10Rik, D16Ertd536e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74185
HGNC: HGNC:4180
Homologene: 129
Cped1
Name: cadherin-like and PC-esterase domain containing 1
Synonyms: A430107O13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 214642
Homologene: 57014
Phlpp2
Name: PH domain and leucine rich repeat protein phosphatase 2
Synonyms: C130044A18Rik, Phlppl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244650
Homologene: 71015
Or6c6c
Name: olfactory receptor family 6 subfamily C member 6C
Synonyms: GA_x6K02T2PULF-11383575-11384519, MOR110-7, Olfr804
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258068
Homologene: 133581
Ano9
Name: anoctamin 9
Synonyms: 5430425C04Rik, Tp53i5, Trp53i5, Tmem16j
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71345
Homologene: 67083
Nrap
Name: nebulin-related anchoring protein
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18175
HGNC: HGNC:7988
Homologene: 4499
Tbx18
Name: T-box18
Synonyms: 2810012F10Rik, 2810404D13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76365
Homologene: 11384
Smarca5
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
Synonyms: Snf2h, D330027N15Rik, 4933427E24Rik, D030040M08Rik, MommeD4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93762
Homologene: 55764
Shox2
Name: SHOX homeobox 2
Synonyms: Prx3, Og12x, 6330543G17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20429
Homologene: 68535
Poll
Name: polymerase (DNA directed), lambda
Synonyms: 1110003P06Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56626
VEGA: 19
HGNC: HGNC:9184
Homologene: 40863
Vmn2r87
Name: vomeronasal 2, receptor 87
Synonyms: EG625131
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625131
Homologene: 129606
Apbb1ip
Name: amyloid beta precursor protein binding family B member 1 interacting protein
Synonyms: proline-rich protein 48, Prp48, 9930118P07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 54519
Homologene: 32434
Or5an1c
Name: olfactory receptor family 5 subfamily AN member 1C
Synonyms: GA_x6K02T2N4A9-18144-19082, MOR214-1, MOR214-9, Olfr262
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258683
Car13
Name: carbonic anhydrase 13
Synonyms: 2310075C21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71934
Homologene: 75207
Tmem243
Name: transmembrane protein 243, mitochondrial
Synonyms: E030031F02Rik, 4930420K17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 652925
Homologene: 41561
Etfrf1
Name: electron transfer flavoprotein regulatory factor 1
Synonyms: Ghiso, 4930469P12Rik, Lyrm5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67636
Homologene: 44219
Ccdc66
Name: coiled-coil domain containing 66
Synonyms: E230015L20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 320234
VEGA: 14
Homologene: 35309
H2-DMb1
Name: histocompatibility 2, class II, locus Mb1
Synonyms: H2-Mb1, H-2Mb1, H2-M beta1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14999
HGNC: HGNC:4935
Homologene: 68231
Gm10549
Name: predicted gene 10549
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 433171
VEGA: 18
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 9,879,081 bp
  • T to C, chromosome 1 at 40,743,857 bp
  • C to A, chromosome 1 at 88,242,420 bp
  • G to A, chromosome 1 at 153,251,065 bp
  • A to G, chromosome 2 at 22,819,705 bp
  • A to T, chromosome 2 at 65,508,574 bp
  • A to G, chromosome 2 at 69,430,307 bp
  • G to A, chromosome 2 at 114,130,611 bp
  • A to T, chromosome 2 at 125,321,676 bp
  • T to A, chromosome 2 at 130,537,621 bp
  • C to G, chromosome 2 at 156,132,660 bp
  • A to G, chromosome 3 at 14,656,297 bp
  • A to G, chromosome 3 at 53,653,960 bp
  • A to T, chromosome 3 at 66,973,851 bp
  • A to T, chromosome 3 at 95,324,853 bp
  • G to T, chromosome 3 at 107,330,564 bp
  • T to A, chromosome 3 at 159,897,437 bp
  • G to A, chromosome 4 at 46,649,913 bp
  • T to A, chromosome 4 at 141,807,173 bp
  • A to T, chromosome 5 at 9,101,361 bp
  • A to G, chromosome 5 at 21,748,831 bp
  • G to A, chromosome 5 at 25,309,708 bp
  • C to A, chromosome 5 at 124,541,439 bp
  • T to A, chromosome 6 at 22,222,546 bp
  • T to A, chromosome 6 at 35,208,837 bp
  • C to T, chromosome 6 at 128,372,603 bp
  • T to C, chromosome 6 at 145,215,562 bp
  • C to A, chromosome 6 at 146,359,392 bp
  • T to G, chromosome 7 at 19,307,150 bp
  • A to T, chromosome 7 at 132,999,344 bp
  • T to A, chromosome 7 at 140,248,961 bp
  • A to G, chromosome 7 at 141,107,814 bp
  • T to A, chromosome 8 at 80,736,731 bp
  • C to T, chromosome 8 at 109,907,513 bp
  • A to G, chromosome 9 at 49,399,784 bp
  • T to A, chromosome 9 at 67,886,246 bp
  • T to A, chromosome 9 at 87,724,355 bp
  • T to A, chromosome 10 at 75,248,459 bp
  • T to A, chromosome 10 at 96,039,772 bp
  • G to C, chromosome 10 at 128,721,083 bp
  • G to A, chromosome 10 at 129,705,647 bp
  • T to A, chromosome 10 at 130,471,979 bp
  • T to A, chromosome 11 at 55,005,828 bp
  • T to A, chromosome 11 at 77,408,143 bp
  • T to A, chromosome 11 at 115,964,277 bp
  • C to T, chromosome 12 at 75,921,226 bp
  • C to T, chromosome 13 at 49,662,447 bp
  • T to C, chromosome 14 at 27,498,473 bp
  • A to G, chromosome 14 at 70,556,476 bp
  • A to G, chromosome 14 at 75,308,965 bp
  • A to G, chromosome 16 at 17,282,932 bp
  • C to T, chromosome 16 at 50,280,392 bp
  • A to G, chromosome 16 at 70,483,914 bp
  • A to G, chromosome 17 at 26,508,169 bp
  • T to C, chromosome 17 at 34,159,425 bp
  • T to C, chromosome 17 at 78,957,215 bp
  • G to A, chromosome 18 at 32,212,173 bp
  • C to T, chromosome 18 at 33,464,182 bp
  • T to C, chromosome 18 at 37,145,667 bp
  • T to A, chromosome 18 at 67,818,883 bp
  • T to A, chromosome 18 at 69,681,812 bp
  • C to T, chromosome 18 at 76,137,393 bp
  • A to G, chromosome 18 at 80,447,422 bp
  • T to C, chromosome 19 at 8,767,739 bp
  • A to T, chromosome 19 at 12,241,141 bp
  • G to A, chromosome 19 at 17,120,910 bp
  • A to T, chromosome 19 at 42,263,319 bp
  • T to G, chromosome 19 at 45,557,870 bp
  • T to A, chromosome 19 at 56,351,622 bp
  • GGGAGGAGGAGGAGGAGGAGGATGAGGAGGAGGAGGAGGAG to GGGAGGAGGAGGAGGAGGATGAGGAGGAGGAGGAGGAG, chromosome X at 20,637,559 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0374 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038580-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.