Strain Name:
C57BL/6J-MtgxR0590Btlr/Mmmh
Stock Number:
038780-MU
Citation ID:
RRID:MMRRC_038780-MU
Other Names:
R0590 (G1), C57BL/6J-MtgxR0590Btlr
Major Collection:

Strain Information

Nfatc2
Name: nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 2
Synonyms: NFAT1-D, NFATp, NFAT1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18019
HGNC: HGNC:7776
Homologene: 7861
Gli1
Name: GLI-Kruppel family member GLI1
Synonyms: Zfp-5, Zfp5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14632
VEGA: 10
HGNC: HGNC:4317
Homologene: 3859
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: C030017F07Rik, Bravo, C130076O07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Phf14
Name: PHD finger protein 14
Synonyms: 1110001C23Rik, 5730446A07Rik, 4932409F11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75725
Homologene: 8775
Hcrtr1
Name: hypocretin (orexin) receptor 1
Synonyms: OX1R
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230777
HGNC: HGNC:4848
Homologene: 37492
Rlf
Name: rearranged L-myc fusion sequence
Synonyms: 9230110M18Rik, MommeD8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 109263
Homologene: 8243
Trim36
Name: tripartite motif-containing 36
Synonyms: Haprin, D18Wsu100e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 28105
VEGA: 18
Homologene: 10275
Zc3h7b
Name: zinc finger CCCH type containing 7B
Synonyms: Scrg3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20286
VEGA: 15
Homologene: 9735
Cad
Name: carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms: 2410008J01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69719
HGNC: HGNC:1424
Homologene: 1412
Ccdc191
Name: coiled-coil domain containing 191
Synonyms: 2610015P09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 212153
Homologene: 19484
Rttn
Name: rotatin
Synonyms: 4921538A15Rik, C530033I08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 246102
VEGA: 18
Homologene: 65275
Ipo5
Name: importin 5
Synonyms: IMB3, RanBP5, Kpnb3, 1110011C18Rik, importin beta 3, 5730478E03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70572
VEGA: 14
HGNC: HGNC:6402
Homologene: 1710
Prdm15
Name: PR domain containing 15
Synonyms: Zfp298, E130018M06Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 114604
Homologene: 56941
Dcaf13
Name: DDB1 and CUL4 associated factor 13
Synonyms: LOC223499, Wdsof1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223499
Homologene: 6430
Gls
Name: glutaminase
Synonyms: B230365M23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14660
HGNC: HGNC:4331
Homologene: 22726
Psip1
Name: PC4 and SFRS1 interacting protein 1
Synonyms: Psip2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 101739
HGNC: HGNC:9527
Homologene: 13242
Kcnh5
Name: potassium voltage-gated channel, subfamily H (eag-related), member 5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238271
VEGA: 12
HGNC: HGNC:6254
Homologene: 15858
Pole
Name: polymerase (DNA directed), epsilon
Synonyms: pol-epsilon
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18973
HGNC: HGNC:9177
Homologene: 4539
Apc
Name: APC, WNT signaling pathway regulator
Synonyms: adenomatosis polyposis coli, Min, CC1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 11789
HGNC: HGNC:583
Homologene: 30950
Nelfa
Name: negative elongation factor complex member A, Whsc2
Synonyms: Whsc2h, Nelf-A, Whsc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 24116
Homologene: 68478
Fhip1a
Name: FHF complex subunit HOOK interacting protein 1A
Synonyms: Fam160a1, 9930021J17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229488
Homologene: 85149
Zfhx4
Name: zinc finger homeodomain 4
Synonyms: Zfh4, Zfh-4, C130041O22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80892
Homologene: 23477
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Wdfy4
Name: WD repeat and FYVE domain containing 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 545030
Homologene: 83473
Ifngr1
Name: interferon gamma receptor 1
Synonyms: CD119, Ifgr, IFN-gamma R, IFN-gammaR, Ifngr, Nktar
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15979
HGNC: HGNC:5439
Homologene: 359
Adamts16
Name: ADAM metallopeptidase with thrombospondin type 1 motif 16
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 271127
Homologene: 15146
Acnat2
Name: acyl-coenzyme A amino acid N-acyltransferase 2
Synonyms: C730036D15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 209186
Homologene: 28287
Ucp1
Name: uncoupling protein 1 (mitochondrial, proton carrier)
Synonyms: Slc25a7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22227
Homologene: 22524
AI661453
Name: expressed sequence AI661453
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224833
Homologene: 138294
Slc4a10
Name: solute carrier family 4, sodium bicarbonate cotransporter-like, member 10
Synonyms: NCBE
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94229
Homologene: 23340
Gria1
Name: glutamate receptor, ionotropic, AMPA1 (alpha 1)
Synonyms: GluR-A, Glur-1, Glur1, 2900051M01Rik, GluA1, Glr1, GluR1, HIPA1, Glr-1, GluRA
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14799
HGNC: HGNC:4571
Homologene: 20226
Adhfe1
Name: alcohol dehydrogenase, iron containing, 1
Synonyms: 6330565B14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76187
Homologene: 5865
Ksr1
Name: kinase suppressor of ras 1
Synonyms: B-KSR1, D11Bhm183e, D11Bhm184e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16706
HGNC: HGNC:6465
Homologene: 8410
Atg2a
Name: autophagy related 2A
Synonyms: 1810013C15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 329015
Homologene: 86985
Kif14
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381293
Homologene: 8916
Or8g19
Name: olfactory receptor family 8 subfamily G member 19
Synonyms: MTPCR56, MOR171-6, GA_x6K02T2KYVW-1037-120, GA_x6K02T2PVTD-32841223-32842158, Olfr242, Olfr27
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258826
VEGA: 9
HGNC: HGNC:8484
Homologene: 110610
Drc1
Name: dynein regulatory complex subunit 1
Synonyms: b2b1654Clo, Ccdc164, Gm1060, LOC381738
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381738
Homologene: 35977
Ocstamp
Name: osteoclast stimulatory transmembrane protein
Synonyms: 4833422F24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74614
Homologene: 41768
Or10ag60
Name: olfactory receptor family 10 subfamily AG member 60
Synonyms: MOR264-4, GA_x6K02T2Q125-49112575-49113519, Olfr1130
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258835
Homologene: 133705
Rusf1
Name: RUS family member 1
Synonyms: BC017158
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233913
Homologene: 11232
Vmn1r23
Name: vomeronasal 1 receptor 23
Synonyms: V1rc24
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171197
Homologene: 110825
Vmn1r17
Name: vomeronasal 1 receptor 17
Synonyms: V1rc16
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171189
Homologene: 115643
Sema6c
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
Synonyms: Sema Y, Semay
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20360
Homologene: 7931
Or8d1
Name: olfactory receptor family 8 subfamily D member 1
Synonyms: Olfr26, MOR171-9, MTPCR09, GA_x6K02T2PVTD-32550930-32551856
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18324
VEGA: 9
HGNC: HGNC:8481
Homologene: 79676
Plk5
Name: polo like kinase 5
Synonyms: 6330514A18Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216166
Homologene: 28072
Nr1h4
Name: nuclear receptor subfamily 1, group H, member 4
Synonyms: FXR, Fxr, RIP14, Rxrip14, HRR1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20186
HGNC: HGNC:7967
Homologene: 3760
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 9,548,153 bp
  • G to A, chromosome 1 at 52,212,375 bp
  • T to C, chromosome 1 at 136,482,472 bp
  • T to C, chromosome 2 at 52,137,290 bp
  • A to T, chromosome 2 at 62,190,893 bp
  • A to G, chromosome 2 at 87,607,994 bp
  • T to A, chromosome 2 at 165,397,751 bp
  • T to C, chromosome 2 at 168,571,199 bp
  • T to A, chromosome 3 at 5,402,633 bp
  • T to C, chromosome 3 at 85,672,376 bp
  • A to G, chromosome 3 at 95,172,623 bp
  • C to T, chromosome 4 at 49,383,273 bp
  • T to C, chromosome 4 at 83,458,144 bp
  • A to G, chromosome 4 at 121,170,833 bp
  • A to G, chromosome 4 at 130,135,694 bp
  • A to G, chromosome 5 at 30,363,136 bp
  • T to C, chromosome 5 at 31,062,231 bp
  • G to A, chromosome 5 at 33,901,825 bp
  • A to G, chromosome 5 at 110,317,926 bp
  • G to A, chromosome 6 at 11,961,578 bp
  • T to C, chromosome 6 at 57,361,014 bp
  • A to G, chromosome 6 at 57,926,364 bp
  • A to G, chromosome 7 at 128,297,470 bp
  • A to G, chromosome 8 at 83,291,603 bp
  • T to A, chromosome 9 at 38,855,470 bp
  • T to C, chromosome 9 at 39,144,721 bp
  • T to A, chromosome 10 at 19,603,942 bp
  • G to A, chromosome 10 at 80,360,223 bp
  • A to G, chromosome 10 at 89,456,567 bp
  • G to T, chromosome 10 at 127,331,563 bp
  • A to T, chromosome 11 at 57,289,409 bp
  • A to G, chromosome 11 at 79,045,140 bp
  • A to G, chromosome 12 at 44,564,032 bp
  • G to T, chromosome 12 at 74,965,261 bp
  • T to C, chromosome 13 at 70,800,954 bp
  • T to A, chromosome 14 at 33,041,174 bp
  • T to C, chromosome 14 at 120,944,357 bp
  • T to A, chromosome 15 at 39,145,085 bp
  • C to T, chromosome 15 at 81,776,998 bp
  • C to T, chromosome 16 at 43,931,341 bp
  • A to G, chromosome 16 at 97,797,761 bp
  • A to G, chromosome 17 at 47,467,074 bp
  • G to T, chromosome 18 at 34,316,230 bp
  • T to G, chromosome 18 at 46,172,576 bp
  • T to C, chromosome 18 at 88,979,635 bp
  • GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC to GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC, chromosome 19 at 6,245,007 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0590 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038780-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.