Strain Name:
C57BL/6J-MtgxR0637Btlr/Mmmh
Stock Number:
038826-MU
Citation ID:
RRID:MMRRC_038826-MU
Other Names:
R0637 (G1), C57BL/6J-MtgxR0637Btlr
Major Collection:

Strain Information

Baiap2
Name: brain-specific angiogenesis inhibitor 1-associated protein 2
Synonyms: IRSp53
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108100
HGNC: HGNC:947
Homologene: 9697
Rbpms
Name: RNA binding protein gene with multiple splicing
Synonyms: hermes, 2700019M19Rik, 2010300K22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19663
Homologene: 38238
Rgs3
Name: regulator of G-protein signaling 3
Synonyms: 4930506N09Rik, C2pa, PDZ-RGS3, RGS3S, C2PA-RGS3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50780
HGNC: HGNC:9999
Homologene: 32440
Pelp1
Name: proline, glutamic acid and leucine rich protein 1
Synonyms: 4930563C04Rik, MNAR
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75273
Homologene: 8664
Chd1
Name: chromodomain helicase DNA binding protein 1
Synonyms: 4930525N21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12648
HGNC: HGNC:1915
Homologene: 68174
Gars1
Name: glycyl-tRNA synthetase 1
Synonyms: Sgrp23, GENA202, Gena201, Gars
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 353172
HGNC: HGNC:4162
Homologene: 1547
Rcc2
Name: regulator of chromosome condensation 2
Synonyms: 2610529N02Rik, 2610510H01Rik, Td60
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 108911
Homologene: 10282
Trim24
Name: tripartite motif-containing 24
Synonyms: Tif1a, D430004I05Rik, A130082H20Rik, TIF1alpha
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21848
Homologene: 20830
Rif1
Name: replication timing regulatory factor 1
Synonyms: 5730435J01Rik, 6530403D07Rik, D2Ertd145e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 51869
Homologene: 41231
Vps18
Name: VPS18 CORVET/HOPS core subunit
Synonyms: 9930024E13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228545
Homologene: 13302
Robo1
Name: roundabout guidance receptor 1
Synonyms: DUTT1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19876
Homologene: 2206
Itgb3
Name: integrin beta 3
Synonyms: platelet glycoprotein IIIa (GP3A), CD61
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16416
HGNC: HGNC:6156
Homologene: 55444
Pgrmc1
Name: progesterone receptor membrane component 1
Synonyms: HPR6.6, PPMR, Vema
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 53328
Homologene: 48457
Sinhcaf
Name: SIN3-HDAC complex associated factor
Synonyms: Tera, Pptcs1, Fam60a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56306
Homologene: 10494
Alms1
Name: ALMS1, centrosome and basal body associated
Synonyms: Alstrom syndrome 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 236266
HGNC: HGNC:428
Homologene: 49406
Fbf1
Name: Fas binding factor 1
Synonyms: 1110033G01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217335
Homologene: 16531
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Fgfr2
Name: fibroblast growth factor receptor 2
Synonyms: Bek, KGFRTr, Fgfr-7, Fgfr-2, Fgfr7, svs, Fgfr2b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14183
HGNC: HGNC:3689
Homologene: 22566
Tenm3
Name: teneurin transmembrane protein 3
Synonyms: Ten-m3, 2610100B16Rik, Odz3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23965
Homologene: 22673
Nol8
Name: nucleolar protein 8
Synonyms: 4921532D18Rik, D13Ertd548e, 5730412B09Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 70930
VEGA: 13
Homologene: 41210
Atrip
Name: ATR interacting protein
Synonyms: 6620401K05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235610
Homologene: 15601
Ncapg
Name: non-SMC condensin I complex, subunit G
Synonyms: MFT.M05.13, Hcapg, 5730507H05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54392
Homologene: 44071
Mtmr4
Name: myotubularin related protein 4
Synonyms: ESTM44, FYVE-DSP2, FYVE zinc finger phosphatase, ZFYVE11
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 170749
HGNC: HGNC:7452
Homologene: 3440
Pink1
Name: PTEN induced putative kinase 1
Synonyms: 1190006F07Rik, brpk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68943
Homologene: 32672
Bnip2
Name: BCL2/adenovirus E1B interacting protein 2
Synonyms: 5730523P12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12175
HGNC: HGNC:1083
Homologene: 3194
Col12a1
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12816
HGNC: HGNC:2188
Homologene: 3217
Tnr
Name: tenascin R
Synonyms: janusin, restrictin, TN-R, J1-tenascin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21960
Homologene: 124416
Il1rl1
Name: interleukin 1 receptor-like 1
Synonyms: T1 gene, T1, ST2, T1/ST2, Fit-1, DER4, ST2L, St2, St2-rs1, Ly84
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17082
HGNC: HGNC:5998
Homologene: 2862
Nav3
Name: neuron navigator 3
Synonyms: Pomfil1p, POMFIL1, 4732483H20Rik, unc53H3, steerin 3, 9630020C08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 260315
Homologene: 56688
Cpne8
Name: copine VIII
Synonyms: 1200003E11Rik, 1500031E20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66871
Homologene: 12049
Mink1
Name: misshapen-like kinase 1 (zebrafish)
Synonyms: Misshapen/NIKs-related kinase, MINK, Ysk2, Map4k6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50932
Homologene: 56762
Vmn2r2
Name: vomeronasal 2, receptor 2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100125586
Homologene: 129753
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Trank1
Name: tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms: A230061D21Rik, LOC235639, C030048J01Rik, Lba1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320429
Homologene: 45845
Pramel25
Name: PRAME like 25
Synonyms: MGC:91194, Gm13023
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 194227
Homologene: 103830
Cacna1i
Name: calcium channel, voltage-dependent, alpha 1I subunit
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239556
HGNC: HGNC:1396
Homologene: 69331
Dcaf17
Name: DDB1 and CUL4 associated factor 17
Synonyms: 2810055O12Rik, A030004A10Rik, 4833418A01Rik, A930009G19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75763
Homologene: 65979
Topaz1
Name: testis and ovary specific PAZ domain containing 1
Synonyms: Gm9524
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 671232
VEGA: 9
Homologene: 19835
Ces2b
Name: carboxyesterase 2B
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234669
HGNC: HGNC:1864
Homologene: 135851
Zkscan4
Name: zinc finger with KRAB and SCAN domains 4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544922
Homologene: 128718
Zfp366
Name: zinc finger protein 366
Synonyms: DC-SCRIPT
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238803
Homologene: 17637
Has1
Name: hyaluronan synthase 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15116
VEGA: 17
HGNC: HGNC:4818
Homologene: 1165
Nfe2l1
Name: nuclear factor, erythroid derived 2,-like 1
Synonyms: TCF-11, NRF1, LCR-F1, TCF11, Lcrf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18023
HGNC: HGNC:7781
Homologene: 20685
Clca3b
Name: chloride channel accessory 3B
Synonyms: Clca4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229927
HGNC: HGNC:2017
Homologene: 135610
Pcdhb15
Name: protocadherin beta 15
Synonyms: Pcdhb7, PcdhbO
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93886
HGNC: HGNC:8692
Homologene: 32429
Hivep3
Name: human immunodeficiency virus type I enhancer binding protein 3
Synonyms: Krc, E030045D18Rik, 2900056N03Rik, Shn3, Schnurri-3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16656
Homologene: 7803
Steap4
Name: STEAP family member 4
Synonyms: Tiarp, Tnfaip9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 117167
Homologene: 36422
Tspoap1
Name: TSPO associated protein 1
Synonyms: peripheral, Bzrap1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207777
Homologene: 37961
Lrrc63
Name: leucine rich repeat containing 63
Synonyms: 4921509B22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70859
Homologene: 52823
Gm17333
Name: predicted gene, 17333
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Lrrc23
Name: leucine rich repeat containing 23
Synonyms: 4921537K05Rik, Lrpb7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16977
Homologene: 5082
Aldh3a1
Name: aldehyde dehydrogenase family 3, subfamily A1
Synonyms: Ahd-4, Ahd4, Aldh3, Aldh
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11670
HGNC: HGNC:405
Homologene: 20175
Cxcr1
Name: C-X-C motif chemokine receptor 1
Synonyms: Il8ra
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227288
HGNC: HGNC:6026
Homologene: 68074
Cbr4
Name: carbonyl reductase 4
Synonyms: A730083J17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234309
Homologene: 57181
Mfhas1
Name: malignant fibrous histiocytoma amplified sequence 1
Synonyms: 2310066G09Rik, D8Ertd91e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52065
Homologene: 3114
1700060C20Rik
Name: RIKEN cDNA 1700060C20 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 73399
Gm7337
Name: predicted gene 7337
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 654494
Aup1
Name: ancient ubiquitous protein 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11993
HGNC: HGNC:891
Homologene: 7239
Gm9892
Name: predicted gene 9892
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 100040220
Or8b41
Name: olfactory receptor family 8 subfamily B member 41
Synonyms: GA_x6K02T2PVTD-31822365-31823309, MOR162-3, MOR162-15_p, Olfr890
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258474
Homologene: 138311
Acat1
Name: acetyl-Coenzyme A acetyltransferase 1
Synonyms: Acat, 6330585C21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110446
HGNC: HGNC:93
Homologene: 6
Gm10309
Name: predicted gene 10309
Type: Gene
Species: Mouse
Chromosome: 17
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • CTTGTTGTTGTTGTTGTTG to CTTGTTGTTGTTGTTGTTGTTG, chromosome 1 at 40,442,574 bp
  • A to G, chromosome 1 at 74,192,839 bp
  • A to C, chromosome 1 at 159,850,335 bp
  • GCCACCA to GCCA, chromosome 2 at 52,110,324 bp
  • T to A, chromosome 2 at 71,060,419 bp
  • C to T, chromosome 2 at 119,293,905 bp
  • T to G, chromosome 2 at 158,195,407 bp
  • T to A, chromosome 3 at 64,126,578 bp
  • A to T, chromosome 3 at 144,827,940 bp
  • T to C, chromosome 4 at 62,646,673 bp
  • T to A, chromosome 4 at 120,132,541 bp
  • G to T, chromosome 4 at 138,318,046 bp
  • T to C, chromosome 4 at 139,399,615 bp
  • T to C, chromosome 4 at 140,717,744 bp
  • A to T, chromosome 4 at 143,793,909 bp
  • T to C, chromosome 5 at 7,978,398 bp
  • A to G, chromosome 5 at 45,687,324 bp
  • A to G, chromosome 5 at 87,851,146 bp
  • C to A, chromosome 6 at 37,958,559 bp
  • G to A, chromosome 6 at 55,069,487 bp
  • T to A, chromosome 6 at 83,056,861 bp
  • A to G, chromosome 6 at 85,623,033 bp
  • A to G, chromosome 6 at 124,778,358 bp
  • A to G, chromosome 6 at 148,930,665 bp
  • T to A, chromosome 7 at 130,171,624 bp
  • G to A, chromosome 8 at 33,806,836 bp
  • C to T, chromosome 8 at 35,590,026 bp
  • T to C, chromosome 8 at 48,236,525 bp
  • G to A, chromosome 8 at 52,196,825 bp
  • T to C, chromosome 8 at 61,490,706 bp
  • C to T, chromosome 8 at 104,834,605 bp
  • T to C, chromosome 9 at 38,143,882 bp
  • C to T, chromosome 9 at 53,587,531 bp
  • T to A, chromosome 9 at 70,003,673 bp
  • T to C, chromosome 9 at 79,656,735 bp
  • C to T, chromosome 9 at 109,061,173 bp
  • T to G, chromosome 9 at 111,390,441 bp
  • T to A, chromosome 9 at 122,791,477 bp
  • A to G, chromosome 9 at 122,797,662 bp
  • T to C, chromosome 10 at 109,770,197 bp
  • A to T, chromosome 11 at 59,051,644 bp
  • G to T, chromosome 11 at 59,082,776 bp
  • G to A, chromosome 11 at 61,215,478 bp
  • T to C, chromosome 11 at 70,395,704 bp
  • C to A, chromosome 11 at 70,601,676 bp
  • A to G, chromosome 11 at 87,611,064 bp
  • T to A, chromosome 11 at 87,777,240 bp
  • T to C, chromosome 11 at 96,827,688 bp
  • T to C, chromosome 11 at 104,658,876 bp
  • C to T, chromosome 11 at 116,160,054 bp
  • G to A, chromosome 11 at 120,000,579 bp
  • T to A, chromosome 13 at 21,481,307 bp
  • C to T, chromosome 13 at 49,662,447 bp
  • C to A, chromosome 13 at 99,228,966 bp
  • A to T, chromosome 14 at 75,098,220 bp
  • A to T, chromosome 15 at 80,372,654 bp
  • C to A, chromosome 15 at 90,648,621 bp
  • C to T, chromosome 16 at 73,001,951 bp
  • AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA to AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA, chromosome 16 at 77,852,878 bp
  • A to G, chromosome 17 at 15,742,288 bp
  • A to G, chromosome 17 at 17,843,863 bp
  • A to G, chromosome 17 at 86,499,035 bp
  • T to A, chromosome 18 at 37,475,566 bp
  • T to C, chromosome X at 36,602,271 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0637 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038826-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.