Strain Name:
C57BL/6J-MtgxR1172Btlr/Mmmh
Stock Number:
039245-MU
Citation ID:
RRID:MMRRC_039245-MU
Other Names:
R1172 (G1), C57BL/6J-MtgxR1172Btlr
Major Collection:

Strain Information

Tyrp1
Name: tyrosinase-related protein 1
Synonyms: TRP1, TRP-1, Oca3, isa, Tyrp
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22178
Homologene: 464
Npr1
Name: natriuretic peptide receptor 1
Synonyms: guanylyl cyclase-A, NPRA, GC-A, NPR-A
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18160
HGNC: HGNC:7943
Homologene: 37367
Map7
Name: microtubule-associated protein 7
Synonyms: ste, Mtap7, mste, mshi, E-MAP-115
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17761
VEGA: 10
HGNC: HGNC:6869
Homologene: 20851
Rpa1
Name: replication protein A1
Synonyms: RF-A, 5031405K23Rik, 70kDa, RP-A, Rpa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68275
Homologene: 2208
Ubap2l
Name: ubiquitin-associated protein 2-like
Synonyms: NICE-4, 4932431F02Rik, A430103N23Rik, 3110083O19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74383
Homologene: 136291
Epc1
Name: enhancer of polycomb homolog 1
Synonyms: 2400007E14Rik, A930032N02Rik, 5730566F07Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13831
Homologene: 32627
Pcnt
Name: pericentrin (kendrin)
Synonyms: m275Asp, Pcnt2, m239Asp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18541
VEGA: 10
Fry
Name: FRY microtubule binding protein
Synonyms: 9330186A19Rik, cg003
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Xrcc6
Name: X-ray repair complementing defective repair in Chinese hamster cells 6
Synonyms: Ku p70, G22p1, Ku70
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14375
HGNC: HGNC:4055
Homologene: 37483
Ywhaq
Name: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta
Synonyms: 2700028P07Rik, 14-3-3 tau, 14-3-3 theta
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22630
Homologene: 105677
Fermt2
Name: fermitin family member 2
Synonyms: Plekhc1, Mig2, Kindlin-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218952
Homologene: 4976
Slc45a4
Name: solute carrier family 45, member 4
Synonyms: 9330175B01Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 106068
Homologene: 69908
Arid1b
Name: AT-rich interaction domain 1B
Synonyms: 9330189K18Rik, B230217J03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 239985
Homologene: 32344
Laptm4a
Name: lysosomal-associated protein transmembrane 4A
Synonyms: Mtrp
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17775
HGNC: HGNC:6924
Homologene: 7427
Cmas
Name: cytidine monophospho-N-acetylneuraminic acid synthetase
Synonyms: CMP-sialic acid synthetase, D6Bwg0250e, CMP-Neu5Ac synthase
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12764
Homologene: 7670
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: Ten-m4, l7Rn3, Odz4, l(7)-3Rn, ELM2, Doc4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23966
Homologene: 8034
Zfp981
Name: zinc finger protein 981
Synonyms: Gm13247
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100041433
Homologene: 133076
Ncr1
Name: natural cytotoxicity triggering receptor 1
Synonyms: NKp46, Ly94, MAR1 (mouse activating receptor 1), Cd335
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17086
HGNC: HGNC:6731
Homologene: 3551
Kank4
Name: KN motif and ankyrin repeat domains 4
Synonyms: Ankrd38
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242553
Homologene: 18244
Hbs1l
Name: Hbs1-like (S. cerevisiae)
Synonyms: 2810035F15Rik, eRFS
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56422
VEGA: 10
HGNC: HGNC:4834
Homologene: 68525
Fmnl2
Name: formin-like 2
Synonyms: 5430425K04Rik, man
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71409
Homologene: 70871
Cblb
Name: Casitas B-lineage lymphoma b
Synonyms: Cbl-b
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208650
VEGA: 16
HGNC: HGNC:1542
Homologene: 15856
Tctn1
Name: tectonic family member 1
Synonyms: G730031O11Rik, Tect1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 654470
Homologene: 49770
Syndig1l
Name: synapse differentiation inducing 1 like
Synonyms: Tmem90a, capucin, LOC238321, SynDIG2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 627191
VEGA: 12
Homologene: 82470
Gtf3c2
Name: general transcription factor IIIC, polypeptide 2, beta
Synonyms: 2610510G03Rik, 1300004C11Rik, TFIIIC110, TFIIIC-BETA
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71752
HGNC: HGNC:4665
Homologene: 37490
Atp10a
Name: ATPase, class V, type 10A
Synonyms: pfatp, Atp10c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11982
Homologene: 56461
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Map3k5
Name: mitogen-activated protein kinase kinase kinase 5
Synonyms: ASK, ASK1, Mekk5, 7420452D20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 26408
HGNC: HGNC:6857
Homologene: 38114
Pik3r4
Name: phosphoinositide-3-kinase regulatory subunit 4
Synonyms: p150, Vps15
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75669
HGNC: HGNC:8982
Homologene: 24678
Gpld1
Name: glycosylphosphatidylinositol specific phospholipase D1
Synonyms: 6330541J12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14756
HGNC: HGNC:4459
Homologene: 1152
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: Mgr1, Mass1, Gpr98, VLGR1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Gm10801
Name: predicted gene 10801
Type: Gene
Species: Mouse
Chromosome: 2
Fbxl13
Name: F-box and leucine-rich repeat protein 13
Synonyms: 4921539K22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320118
Homologene: 27057
Vmn2r72
Name: vomeronasal 2, receptor 72
Synonyms: EG244114, Vmn2r72-ps
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244114
Homologene: 115466
Lrrc19
Name: leucine rich repeat containing 19
Synonyms: 9130022A01Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100061
Homologene: 36410
Txlnb
Name: taxilin beta
Synonyms: 2310001N14Rik, Mdp77
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 378431
Homologene: 44534
Vmn2r66
Name: vomeronasal 2, receptor 66
Synonyms: F830104D24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233437
Homologene: 115466
Eml6
Name: echinoderm microtubule associated protein like 6
Synonyms: 2900083P10Rik, C230094A16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237711
Homologene: 104282
Fsd2
Name: fibronectin type III and SPRY domain containing 2
Synonyms: Spryd1, 9830160G03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244091
Homologene: 18252
Bst1
Name: bone marrow stromal cell antigen 1
Synonyms: CD157, Ly65, Bp3, Bsta1, 114/A10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12182
HGNC: HGNC:1118
Homologene: 3198
Rxfp2
Name: relaxin/insulin-like family peptide receptor 2
Synonyms: LGR8, Gpr106, Great
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 140498
Homologene: 15402
C9orf72
Name: C9orf72, member of C9orf72-SMCR8 complex
Synonyms: Dennd9, 3110043O21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73205
Homologene: 10137
Adam7
Name: a disintegrin and metallopeptidase domain 7
Synonyms: EAP1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11500
HGNC: HGNC:214
Homologene: 2830
Agbl4
Name: ATP/GTP binding protein-like 4
Synonyms: 4931433A01Rik, 4930578N11Rik, Ccp6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 78933
Homologene: 84880
Lamc2
Name: laminin, gamma 2
Synonyms: nicein, 100kDa
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16782
HGNC: HGNC:6493
Homologene: 4062
Idh1
Name: isocitrate dehydrogenase 1 (NADP+), soluble
Synonyms: Id-1, E030024J03Rik, IDPc, Idh-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15926
HGNC: HGNC:5382
Homologene: 21195
Accsl
Name: 1-aminocyclopropane-1-carboxylate synthase (inactive)-like
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381411
Homologene: 86007
Vmn2r87
Name: vomeronasal 2, receptor 87
Synonyms: EG625131
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625131
Homologene: 129606
Mettl24
Name: methyltransferase like 24
Synonyms: 9030224M15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 327747
Homologene: 65335
Vdr
Name: vitamin D (1,25-dihydroxyvitamin D3) receptor
Synonyms: Nr1i1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22337
Homologene: 37297
Npm2
Name: nucleophosmin/nucleoplasmin 2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328440
VEGA: 14
HGNC: HGNC:7930
Homologene: 15349
Rftn2
Name: raftlin family member 2
Synonyms: 2700010E02Rik, 3222401M22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74013
Homologene: 16954
Glipr1l2
Name: GLI pathogenesis-related 1 like 2
Synonyms: 4921508O11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67537
Homologene: 17579
Bivm
Name: basic, immunoglobulin-like variable motif containing
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 246229
Homologene: 9783
Nkx3-1
Name: NK3 homeobox 1
Synonyms: Nkx-3.1, Bax, NKX3.1, bagpipe, NKX3A
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18095
HGNC: HGNC:7838
Homologene: 4494
Ccdc28b
Name: coiled coil domain containing 28B
Synonyms: 1810010N17Rik, 1110002E08Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66264
Homologene: 11509
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546165
VEGA: 9
AC125117.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Mosmo
Name: modulator of smoothened
Synonyms: BC030336
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233812
Homologene: 16600
Nudt21
Name: nudix hydrolase 21
Synonyms: 3110048P04Rik, nudix (nucleoside diphosphate linked moiety X)-type motif 21, Cpsf5, 5730530J16Rik, 25kDa
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68219
Homologene: 5090
Zfp185
Name: zinc finger protein 185
Synonyms: P1-
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 22673
Homologene: 137227
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 44,126,782 bp
  • A to G, chromosome 1 at 55,211,217 bp
  • G to T, chromosome 1 at 65,161,160 bp
  • A to T, chromosome 1 at 153,166,287 bp
  • A to T, chromosome 2 at 53,072,274 bp
  • A to T, chromosome 2 at 93,866,244 bp
  • C to T, chromosome 2 at 98,663,907 bp
  • A to T, chromosome 2 at 125,394,687 bp
  • A to T, chromosome 3 at 90,023,500 bp
  • T to A, chromosome 3 at 90,461,382 bp
  • C to A, chromosome 4 at 35,218,630 bp
  • C to T, chromosome 4 at 80,844,868 bp
  • A to T, chromosome 4 at 94,638,389 bp
  • T to C, chromosome 4 at 98,765,569 bp
  • A to T, chromosome 4 at 111,656,318 bp
  • T to C, chromosome 4 at 129,620,889 bp
  • G to A, chromosome 4 at 146,537,764 bp
  • A to T, chromosome 5 at 21,620,604 bp
  • A to T, chromosome 5 at 31,168,075 bp
  • A to G, chromosome 5 at 43,825,408 bp
  • G to A, chromosome 5 at 122,251,689 bp
  • T to C, chromosome 5 at 150,051,556 bp
  • G to A, chromosome 5 at 150,481,494 bp
  • G to T, chromosome 6 at 142,756,878 bp
  • T to A, chromosome 7 at 4,338,121 bp
  • T to C, chromosome 7 at 58,803,766 bp
  • T to C, chromosome 7 at 81,559,770 bp
  • G to T, chromosome 7 at 85,005,591 bp
  • T to A, chromosome 7 at 85,751,944 bp
  • A to T, chromosome 7 at 96,848,044 bp
  • A to G, chromosome 7 at 120,730,522 bp
  • T to C, chromosome 8 at 94,031,129 bp
  • G to T, chromosome 9 at 105,663,174 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • A to G, chromosome 10 at 17,842,756 bp
  • G to A, chromosome 10 at 20,056,648 bp
  • G to A, chromosome 10 at 20,245,299 bp
  • A to G, chromosome 10 at 21,304,638 bp
  • G to A, chromosome 10 at 40,737,708 bp
  • A to T, chromosome 10 at 76,393,044 bp
  • C to A, chromosome 10 at 112,083,466 bp
  • T to C, chromosome 10 at 130,477,584 bp
  • A to G, chromosome 11 at 29,749,824 bp
  • A to T, chromosome 11 at 75,312,393 bp
  • T to C, chromosome 12 at 8,936,716 bp
  • T to C, chromosome 12 at 21,395,023 bp
  • T to A, chromosome 12 at 84,679,168 bp
  • A to G, chromosome 13 at 24,957,566 bp
  • A to T, chromosome 13 at 81,557,063 bp
  • T to C, chromosome 14 at 45,459,968 bp
  • T to C, chromosome 14 at 51,315,891 bp
  • T to G, chromosome 14 at 68,514,921 bp
  • T to C, chromosome 14 at 69,191,985 bp
  • T to A, chromosome 14 at 70,652,221 bp
  • C to T, chromosome 15 at 73,605,429 bp
  • A to G, chromosome 15 at 82,031,163 bp
  • A to T, chromosome 15 at 97,869,333 bp
  • T to C, chromosome 16 at 52,186,240 bp
  • T to A, chromosome 17 at 5,339,300 bp
  • A to C, chromosome 18 at 6,490,525 bp
  • A to T, chromosome X at 72,999,323 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1172 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039245-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.