Strain Name:
C57BL/6J-MtgxR1495Btlr/Mmmh
Stock Number:
039546-MU
Citation ID:
RRID:MMRRC_039546-MU
Other Names:
R1495 (G1), C57BL/6J-MtgxR1495Btlr
Major Collection:

Strain Information

Suz12
Name: SUZ12 polycomb repressive complex 2 subunit
Synonyms: D11Ertd530e, 2610028O16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52615
Homologene: 32256
Aggf1
Name: angiogenic factor with G patch and FHA domains 1
Synonyms: 2310029P06Rik, VG5Q, 2010009L17Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66549
Homologene: 41220
Slc12a6
Name: solute carrier family 12, member 6
Synonyms: KCC3, gaxp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107723
Homologene: 21069
Cdh3
Name: cadherin 3
Synonyms: P-cadherin, Pcad, Cadp
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12560
HGNC: HGNC:1762
Homologene: 20425
Psen2
Name: presenilin 2
Synonyms: Ad4h, ALG-3, PS-2, PS2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19165
HGNC: HGNC:9509
Homologene: 386
Agt
Name: angiotensinogen
Synonyms: Serpina8, angiotensin precursor, Aogen
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11606
HGNC: HGNC:333
Homologene: 14
Egf
Name: epidermal growth factor
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13645
HGNC: HGNC:3229
Homologene: 1483
Snx1
Name: sorting nexin 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56440
Homologene: 99716
Cbfa2t2
Name: CBFA2/RUNX1 translocation partner 2
Synonyms: C330013D05Rik, MTGR1, Cbfa2t2h
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12396
HGNC: HGNC:1536
Homologene: 3733
Kmt2e
Name: lysine (K)-specific methyltransferase 2E
Synonyms: 9530077A04Rik, Mll5, 1810033J14Rik, D230038D11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69188
Homologene: 18822
Pecam1
Name: platelet/endothelial cell adhesion molecule 1
Synonyms: PECAM-1, Cd31
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18613
HGNC: HGNC:8823
Homologene: 47925
Osbpl1a
Name: oxysterol binding protein-like 1A
Synonyms: G430090F17Rik, LOC328902
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 64291
Homologene: 84746
Adck2
Name: aarF domain containing kinase 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 57869
Homologene: 49103
Uchl5
Name: ubiquitin carboxyl-terminal esterase L5
Synonyms: 5830413B11Rik, Uch37
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56207
Homologene: 9326
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Usp14
Name: ubiquitin specific peptidase 14
Synonyms: nmf375, 2610037B11Rik, NMF375, ax, 2610005K12Rik, dUB-type TGT, ataxia
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 59025
Homologene: 3780
Ccdc91
Name: coiled-coil domain containing 91
Synonyms: 1700086G08Rik, 1810060J02Rik, p56
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67015
Homologene: 10131
Fcho2
Name: FCH domain only 2
Synonyms: 5832424M12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218503
VEGA: 13
Homologene: 9030
Cyb5a
Name: cytochrome b5 type A (microsomal)
Synonyms: 0610009N12Rik, Cyb5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 109672
HGNC: HGNC:2570
Homologene: 41475
Taf4
Name: TATA-box binding protein associated factor 4
Synonyms: Taf2c1, TAFII130, TAFII135, Taf4a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228980
Homologene: 55723
Epc2
Name: enhancer of polycomb homolog 2
Synonyms: D2Ertd694e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227867
Homologene: 32274
Ranbp3
Name: RAN binding protein 3
Synonyms: 2610024N24Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71810
VEGA: 17
HGNC: HGNC:9850
Homologene: 136516
Cnot9
Name: CCR4-NOT transcription complex, subunit 9
Synonyms: 2610007F23Rik, FL10, Rqcd1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 58184
Homologene: 3973
4833420G17Rik
Name: RIKEN cDNA 4833420G17 gene
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67392
VEGA: 13
Homologene: 18889
Gabbr1
Name: gamma-aminobutyric acid type B receptor subunit 1
Synonyms: GABAB1, GABAbR1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 54393
HGNC: HGNC:4070
Homologene: 1132
Kank1
Name: KN motif and ankyrin repeat domains 1
Synonyms: A930031B09Rik, D330024H06Rik, Ankrd15
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107351
Homologene: 17706
Lyzl1
Name: lysozyme-like 1
Synonyms: 1700038F02Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67328
Homologene: 81913
Glg1
Name: golgi apparatus protein 1
Synonyms: CFR, Selel, CFR-1, MG-160, MG160, ESL-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20340
HGNC: HGNC:4316
Homologene: 7533
Sptbn2
Name: spectrin beta, non-erythrocytic 2
Synonyms: Spnb3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20743
VEGA: 19
Homologene: 48482
Extl3
Name: exostosin-like glycosyltransferase 3
Synonyms: 2900009G18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54616
VEGA: 14
HGNC: HGNC:3518
Homologene: 1103
Nipbl
Name: NIPBL cohesin loading factor
Synonyms: 4933421G18Rik, 4921518A06Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71175
VEGA: 15
Homologene: 15850
Retreg3
Name: reticulophagy regulator family member 3
Synonyms: 1300010M03Rik, Fam134c, 4933404C01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67998
Homologene: 23585
Ccdc171
Name: coiled-coil domain containing 171
Synonyms: 4930473A06Rik, 4930418J05Rik, A330015D16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320226
Homologene: 27942
Sec24b
Name: SEC24 homolog B, COPII coat complex component
Synonyms: SEC24
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99683
Homologene: 55968
Trpc6
Name: transient receptor potential cation channel, subfamily C, member 6
Synonyms: Trrp6, mtrp6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22068
VEGA: 9
Homologene: 37944
Fat2
Name: FAT atypical cadherin 2
Synonyms: EMI2, mKIAA0811, LOC245827, Fath2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Dgkg
Name: diacylglycerol kinase, gamma
Synonyms: 2900055E17Rik, E430001K23Rik, Dagk3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110197
HGNC: HGNC:2853
Homologene: 1029
Ptprh
Name: protein tyrosine phosphatase receptor type H
Synonyms: SAP-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545902
HGNC: HGNC:9672
Homologene: 37693
Cntnap4
Name: contactin associated protein-like 4
Synonyms: Caspr4, E130114F09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170571
Homologene: 24912
Acot10
Name: acyl-CoA thioesterase 10
Synonyms: p48, MT-ACT48, Acate3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 64833
VEGA: 15
Homologene: 8206
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: OTTMUSG00000005786, LOC380698
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Gprc6a
Name: G protein-coupled receptor, family C, group 6, member A
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 210198
VEGA: 10
Homologene: 17529
Adcy2
Name: adenylate cyclase 2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210044
VEGA: 13
HGNC: HGNC:233
Homologene: 75133
Arvcf
Name: armadillo repeat gene deleted in velocardiofacial syndrome
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11877
HGNC: HGNC:728
Homologene: 31046
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: E130113P14Rik, bl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Clstn3
Name: calsyntenin 3
Synonyms: Cst-3, alcadein-beta, CSTN3, Clstn3b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232370
Homologene: 22836
Ankar
Name: ankyrin and armadillo repeat containing
Synonyms: 4932422E22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319695
Homologene: 85163
Fam227a
Name: family with sequence similarity 227, member A
Synonyms: 4933432B09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75729
Homologene: 123434
Akt3
Name: thymoma viral proto-oncogene 3
Synonyms: Nmf350, D930002M15Rik, PKB gamma
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23797
HGNC: HGNC:393
Homologene: 55904
Disp3
Name: dispatched RND transporter family member 3
Synonyms: Ptchd2, G630052C06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242748
Homologene: 25712
Extl1
Name: exostosin-like glycosyltransferase 1
Synonyms: D430033M16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56219
HGNC: HGNC:3515
Homologene: 3277
Cyp2c23
Name: cytochrome P450, family 2, subfamily c, polypeptide 23
Synonyms: Cyp2c44
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226143
Homologene: 115563
Tec
Name: tec protein tyrosine kinase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21682
Homologene: 1302
Usp45
Name: ubiquitin specific petidase 45
Synonyms: Gcap7, 3110003C05Rik, 4930550B20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77593
Homologene: 17674
Zyg11b
Name: zyg-ll family member B, cell cycle regulator
Synonyms: LOC242610, 2810482G21Rik, 1110046I03Rik, D4Mgi23
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 414872
Homologene: 14600
Clip2
Name: CAP-GLY domain containing linker protein 2
Synonyms: CLIP-115, WSCR4, Cyln2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269713
HGNC: HGNC:2586
Homologene: 20718
Prkd1
Name: protein kinase D1
Synonyms: Pkcm, Prkcm, PKD1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18760
VEGA: 12
HGNC: HGNC:9407
Homologene: 55680
Or9a2
Name: olfactory receptor family 9 subfamily A member 2
Synonyms: GA_x6K02T2P3E9-5780974-5781915, MOR120-1, Olfr459
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258569
Homologene: 83448
Pank1
Name: pantothenate kinase 1
Synonyms: Pank1b, 4632412I06Rik, Pank1, 5430426F23Rik, Pank1a
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 75735
VEGA: 19
HGNC: HGNC:8598
Homologene: 56979
Acsm2
Name: acyl-CoA synthetase medium-chain family member 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233799
Homologene: 70404
Gm7030
Name: predicted gene 7030
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 630294
Homologene: 133121
Serpinb7
Name: serine (or cysteine) peptidase inhibitor, clade B, member 7
Synonyms: ovalbumin, 4631416M05Rik, megsin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 116872
Homologene: 68363
Ptgs1
Name: prostaglandin-endoperoxide synthase 1
Synonyms: COX1, Cox-1, cyclooxygenase 1, Cox-3, Pghs1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19224
HGNC: HGNC:9604
Homologene: 743
Krt75
Name: keratin 75
Synonyms: Krtcap1, 4732468K03Rik, K6hf, Krt2-6hf
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 109052
Homologene: 20983
Vmn1r6
Name: vomeronasal 1 receptor 6
Synonyms: V1rc20
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171193
Homologene: 128340
Gabra1
Name: gamma-aminobutyric acid type A receptor subunit alpha 1
Synonyms: GABAA alpha 1, GABAAR alpha1, Gabra-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14394
HGNC: HGNC:4075
Homologene: 629
Sesn3
Name: sestrin 3
Synonyms: SEST3, 5630400E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75747
Homologene: 14386
Zfp84
Name: zinc finger protein 84
Synonyms: C86188, 4633401C23Rik, 2210410P13Rik, Zfp69, KRAB18
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74352
Homologene: 51858
Jph1
Name: junctophilin 1
Synonyms: mitsugumin72, JP-1, ENSMUSG00000054314
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 57339
Homologene: 10761
Prdm12
Name: PR domain containing 12
Synonyms: LOC381359
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381359
Homologene: 10999
Ccdc9b
Name: coiled-coil domain containing 9B
Synonyms: A430105I19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214239
Homologene: 128188
Tmco5b
Name: transmembrane and coiled-coil domains 5B
Synonyms: 4930563P21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75275
Homologene: 52839
Defa38
Name: defensin, alpha, 38
Synonyms: Gm14851
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 634825
Homologene: 85974
Dbil5
Name: diazepam binding inhibitor-like 5
Synonyms: ELP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13168
Homologene: 10951
Akap14
Name: A kinase anchor protein 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 434756
Homologene: 32512
Slc25a53
Name: solute carrier family 25, member 53
Synonyms: 2310046F18Rik, Mcart6, 2810402A17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 67062
Homologene: 47795
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 17,091,652 bp
  • T to C, chromosome 1 at 72,643,291 bp
  • A to G, chromosome 1 at 74,523,600 bp
  • A to T, chromosome 1 at 107,451,660 bp
  • C to T, chromosome 1 at 143,799,937 bp
  • T to C, chromosome 1 at 177,103,042 bp
  • C to T, chromosome 1 at 180,228,854 bp
  • T to A, chromosome 2 at 31,640,193 bp
  • T to A, chromosome 2 at 36,245,032 bp
  • A to G, chromosome 2 at 49,536,663 bp
  • T to C, chromosome 2 at 112,354,190 bp
  • T to C, chromosome 2 at 113,290,791 bp
  • T to G, chromosome 2 at 118,760,532 bp
  • T to C, chromosome 2 at 154,500,558 bp
  • A to G, chromosome 2 at 179,933,027 bp
  • T to A, chromosome 3 at 129,713,006 bp
  • C to T, chromosome 3 at 129,990,287 bp
  • C to A, chromosome 4 at 21,797,385 bp
  • A to T, chromosome 4 at 83,681,095 bp
  • G to A, chromosome 4 at 108,266,213 bp
  • TGCGTTGCACCGATACCGGG to TG, chromosome 4 at 134,357,677 bp
  • T to C, chromosome 4 at 148,249,825 bp
  • A to G, chromosome 5 at 23,499,327 bp
  • A to T, chromosome 5 at 72,786,755 bp
  • A to G, chromosome 5 at 96,528,586 bp
  • A to G, chromosome 5 at 134,518,042 bp
  • T to C, chromosome 6 at 39,581,844 bp
  • T to G, chromosome 6 at 41,771,903 bp
  • T to A, chromosome 6 at 57,003,073 bp
  • T to C, chromosome 6 at 124,449,917 bp
  • A to G, chromosome 6 at 147,534,172 bp
  • T to A, chromosome 7 at 4,580,889 bp
  • T to A, chromosome 7 at 29,777,303 bp
  • T to A, chromosome 7 at 116,388,065 bp
  • A to G, chromosome 7 at 119,578,126 bp
  • T to A, chromosome 8 at 21,095,201 bp
  • C to T, chromosome 8 at 106,538,997 bp
  • T to C, chromosome 8 at 111,197,675 bp
  • T to G, chromosome 8 at 112,881,763 bp
  • A to G, chromosome 8 at 124,559,455 bp
  • T to C, chromosome 9 at 8,626,789 bp
  • T to C, chromosome 9 at 14,308,521 bp
  • T to A, chromosome 9 at 66,096,597 bp
  • T to A, chromosome 10 at 51,628,437 bp
  • T to C, chromosome 11 at 42,154,944 bp
  • T to A, chromosome 11 at 55,262,673 bp
  • C to T, chromosome 11 at 59,080,160 bp
  • T to A, chromosome 11 at 76,218,450 bp
  • T to A, chromosome 11 at 80,010,652 bp
  • A to G, chromosome 11 at 101,099,144 bp
  • T to C, chromosome 11 at 106,688,856 bp
  • T to C, chromosome 12 at 50,366,352 bp
  • A to T, chromosome 13 at 62,774,270 bp
  • G to T, chromosome 13 at 68,796,535 bp
  • G to A, chromosome 13 at 95,356,413 bp
  • A to G, chromosome 13 at 98,749,850 bp
  • A to G, chromosome 13 at 119,477,820 bp
  • A to T, chromosome 14 at 65,075,867 bp
  • T to G, chromosome 15 at 8,351,280 bp
  • G to A, chromosome 15 at 20,665,507 bp
  • C to T, chromosome 15 at 79,626,245 bp
  • G to A, chromosome 15 at 101,573,873 bp
  • T to A, chromosome 16 at 18,389,386 bp
  • A to T, chromosome 16 at 22,500,379 bp
  • T to C, chromosome 17 at 36,127,898 bp
  • A to G, chromosome 17 at 37,055,940 bp
  • C to T, chromosome 17 at 56,705,527 bp
  • G to T, chromosome 18 at 4,181,192 bp
  • A to T, chromosome 18 at 10,004,994 bp
  • T to A, chromosome 18 at 12,758,839 bp
  • T to A, chromosome 18 at 84,851,480 bp
  • T to G, chromosome 19 at 4,718,976 bp
  • C to G, chromosome 19 at 25,410,349 bp
  • A to G, chromosome 19 at 34,877,680 bp
  • A to G, chromosome 19 at 44,005,508 bp
  • T to C, chromosome X at 37,163,965 bp
  • C to A, chromosome X at 137,015,335 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1495 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039546-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.