Strain Name:
C57BL/6J-MtgxR1601Btlr/Mmmh
Stock Number:
039638-MU
Citation ID:
RRID:MMRRC_039638-MU
Other Names:
R1601 (G1), C57BL/6J-MtgxR1601Btlr
Major Collection:

Strain Information

Arhgef7
Name: Rho guanine nucleotide exchange factor
Synonyms: PIX, betaPix-b, betaPix, Pak interacting exchange factor, p85SPR, betaPix-c, Cool, cool-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54126
Homologene: 2895
Sbf2
Name: SET binding factor 2
Synonyms: B430219L04Rik, mMTMH1, 4833411B01Rik, SBF2, Mtmr13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319934
HGNC: HGNC:2135
Homologene: 41810
Adgre1
Name: adhesion G protein-coupled receptor E1
Synonyms: EGF-TM7, Ly71, F4/80, Emr1, TM7LN3, DD7A5-7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13733
VEGA: 17
HGNC: HGNC:3336
Homologene: 1493
Enah
Name: ENAH actin regulator
Synonyms: Mena, Ndpp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13800
Homologene: 134005
Thrap3
Name: thyroid hormone receptor associated protein 3
Synonyms: Trap150, 9330151F09Rik, B230333E16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230753
Homologene: 31289
Nomo1
Name: nodal modulator 1
Synonyms: Nomo, D7Ertd156e, PM5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 211548
Homologene: 13810
Sbno2
Name: strawberry notch 2
Synonyms: Stno
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216161
VEGA: 10
Homologene: 8981
Dop1a
Name: DOP1 leucine zipper like protein A
Synonyms: D9Ertd809e, Dopey1, B130005I07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320615
Homologene: 26645
Mcm5
Name: minichromosome maintenance complex component 5
Synonyms: mCD46, Cdc46, Mcmd5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17218
HGNC: HGNC:6948
Homologene: 4904
Elp1
Name: elongator complex protein 1
Synonyms: C78473, Ikbkap, IKAP, 3110040G09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230233
HGNC: HGNC:5959
Homologene: 2699
Ncapd2
Name: non-SMC condensin I complex, subunit D2
Synonyms: CAP-D2, 2810406C15Rik, CNAP1, 2810465G24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68298
Homologene: 6497
Tspan5
Name: tetraspanin 5
Synonyms: NET-4, 4930505M03Rik, Tm4sf9, 2810455A09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56224
Homologene: 4182
Kdm3b
Name: KDM3B lysine (K)-specific demethylase 3B
Synonyms: JHDM2B, Jmjd1b, 5830462I21Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 277250
VEGA: 18
HGNC: HGNC:1337
Homologene: 41145
Fabp3
Name: fatty acid binding protein 3, muscle and heart
Synonyms: Fabph-1, Mdgi, Fabph1, H-FABP, Fabph-4, Fabp3, Fabph4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14077
HGNC: HGNC:3557
Homologene: 68379
Adgrb2
Name: adhesion G protein-coupled receptor B2
Synonyms: Bai2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230775
HGNC: HGNC:944
Homologene: 1288
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Vps13b
Name: vacuolar protein sorting 13B
Synonyms: Coh1, 2310042E16Rik, 1810042B05Rik, C330002D13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 666173
VEGA: 15
HGNC: HGNC:2183
Homologene: 49516
Prox1
Name: prospero homeobox 1
Synonyms: A230003G05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19130
HGNC: HGNC:9459
Homologene: 2069
Onecut1
Name: one cut domain, family member 1
Synonyms: Hnf6, Hfh12, Oc1, D9Ertd423e, OC-1, HNF6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15379
HGNC: HGNC:8138
Homologene: 3309
Anxa7
Name: annexin A7
Synonyms: synexin, Anx7
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11750
VEGA: 14
HGNC: HGNC:545
Homologene: 36149
Itsn2
Name: intersectin 2
Synonyms: Sh3p18, Ese2, Sh3d1B, Eh domain, SH3 domain regulator of endocytosis 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20403
VEGA: 12
HGNC: HGNC:6184
Homologene: 22627
Ddx11
Name: DEAD/H box helicase 11
Synonyms: 4732462I11Rik, CHLR1, essa15a, KRG2, CHL1, DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320209
VEGA: 17
Homologene: 68973
Smox
Name: spermine oxidase
Synonyms: B130066H01Rik, SMO
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228608
Homologene: 69268
Kcng3
Name: potassium voltage-gated channel, subfamily G, member 3
Synonyms: Kv10.1a, KV6.3, Kv10.1b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225030
VEGA: 17
Homologene: 15168
Cdc42bpa
Name: CDC42 binding protein kinase alpha
Synonyms: A930014J19Rik, DMPK-like
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226751
HGNC: HGNC:1737
Homologene: 55765
Acad10
Name: acyl-Coenzyme A dehydrogenase family, member 10
Synonyms: 2410021P16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71985
Homologene: 49825
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Fat2
Name: FAT atypical cadherin 2
Synonyms: EMI2, mKIAA0811, LOC245827, Fath2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Kidins220
Name: kinase D-interacting substrate 220
Synonyms: 3110039L19Rik, C330002I19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 77480
VEGA: 12
Homologene: 14254
Mrc1
Name: mannose receptor, C type 1
Synonyms: MR, CD206
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17533
HGNC: HGNC:7228
Homologene: 37622
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Ptprh
Name: protein tyrosine phosphatase receptor type H
Synonyms: SAP-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545902
HGNC: HGNC:9672
Homologene: 37693
Dock10
Name: dedicator of cytokinesis 10
Synonyms: A630054M16Rik, Zizimin3, Jr5, Jr4, ZIZ3, 9330153B10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210293
Homologene: 45952
Gas6
Name: growth arrest specific 6
Synonyms: Gas-6, GAS 6, growth arrest-specific
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14456
HGNC: HGNC:4168
Homologene: 638
Trank1
Name: tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms: C030048J01Rik, LOC235639, A230061D21Rik, Lba1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320429
Homologene: 45845
Lnx2
Name: ligand of numb-protein X 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 140887
Homologene: 17737
Rnpepl1
Name: arginyl aminopeptidase (aminopeptidase B)-like 1
Synonyms: 1110014H17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108657
Homologene: 36367
Me1
Name: malic enzyme 1, NADP(+)-dependent, cytosolic
Synonyms: Mod-1, Mod1, D9Ertd267e, Mdh-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17436
HGNC: HGNC:6983
Homologene: 134785
Itga10
Name: integrin, alpha 10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213119
HGNC: HGNC:6135
Homologene: 2697
C9orf72
Name: C9orf72, member of C9orf72-SMCR8 complex
Synonyms: Dennd9, 3110043O21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73205
Homologene: 10137
Ehhadh
Name: enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase
Synonyms: 1300002P22Rik, HD, L-PBE, L-bifunctional enzyme, MFP1, MFP
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74147
HGNC: HGNC:3247
Homologene: 1486
Or4e2
Name: olfactory receptor family 4 subfamily E member 2
Synonyms: GA_x6K02T2RJGY-534312-533386, MOR83, Olfr1509, MOR244-3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 57271
HGNC: HGNC:8297
Homologene: 41378
Hrh4
Name: histamine receptor H4
Synonyms: H4R
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225192
VEGA: 18
Homologene: 11002
Krt82
Name: keratin 82
Synonyms: Krt2-20
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 114566
VEGA: 15
HGNC: HGNC:6459
Homologene: 13200
Myo18b
Name: myosin XVIIIb
Synonyms: 4932408L24Rik, 4933411E19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74376
Homologene: 53435
4933416C03Rik
Name: RIKEN cDNA 4933416C03 gene
Type: Gene
Species: Mouse
Chromosome: 10
Tmtc4
Name: transmembrane and tetratricopeptide repeat containing 4
Synonyms: 5730419O14Rik, 4930403J22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70551
Homologene: 32796
Cyp24a1
Name: cytochrome P450, family 24, subfamily a, polypeptide 1
Synonyms: 24-OHase, Cyp24, CP24, 25-hydroxyvitamin D-24-hydroxylase
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13081
HGNC: HGNC:2602
Homologene: 68094
Ido2
Name: indoleamine 2,3-dioxygenase 2
Synonyms: Ido2, Indol1, C230043N17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 209176
Homologene: 48830
1110032F04Rik
Name: RIKEN cDNA 1110032F04 gene
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68725
Homologene: 110165
Tdrd9
Name: tudor domain containing 9
Synonyms: 4930441E05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74691
Homologene: 14311
Crx
Name: cone-rod homeobox
Synonyms: Crx1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12951
HGNC: HGNC:2383
Homologene: 467
Olfr179
Name: olfactory receptor 179
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Cdk14
Name: cyclin dependent kinase 14
Synonyms: Pftk1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18647
HGNC: HGNC:8883
Homologene: 7888
Adgra2
Name: adhesion G protein-coupled receptor A2
Synonyms: Gpr124, 8430414O08Rik, Tem5, 9530074E10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78560
Homologene: 13112
Cnksr1
Name: connector enhancer of kinase suppressor of Ras 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 194231
Homologene: 4604
Cnbd2
Name: cyclic nucleotide binding domain containing 2
Synonyms: 4921517L17Rik, 5430421B09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70873
Homologene: 15440
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546165
VEGA: 9
Or7a41
Name: olfactory receptor family 7 subfamily A member 41
Synonyms: Olfr57, IF12, GA_x6K02T2QGN0-2777431-2776472, MOR139-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18357
Homologene: 133620
Paqr3
Name: progestin and adipoQ receptor family member III
Synonyms: RKTG, 6330415A20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231474
Homologene: 71077
Sars2
Name: seryl-aminoacyl-tRNA synthetase 2
Synonyms: D7Ertd353e, 2410015F05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71984
Homologene: 6073
Xbp1
Name: X-box binding protein 1
Synonyms: D11Ertd39e, TREB5, TREB-5, XBP-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22433
Homologene: 3722
Or2b2
Name: olfactory receptor family 2 subfamily B member 2
Synonyms: MOR256-60, MOR256-35, Olfr1359, GA_x6K02T2QHY8-11534186-11533245
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 258067
Homologene: 11056
Fbxo4
Name: F-box protein 4
Synonyms: 1700096C12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 106052
Homologene: 8134
Prdx5
Name: peroxiredoxin 5
Synonyms: AOEB166, PrxV, AOPP, PMP20, Prdx6, PrxV, peroxiredoxin V
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54683
HGNC: HGNC:9355
Homologene: 8076
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 80,549,802 bp
  • A to T, chromosome 1 at 92,917,222 bp
  • T to A, chromosome 1 at 180,065,001 bp
  • A to T, chromosome 1 at 181,919,620 bp
  • T to C, chromosome 1 at 190,161,006 bp
  • A to G, chromosome 2 at 14,293,437 bp
  • A to T, chromosome 2 at 52,287,252 bp
  • C to A, chromosome 2 at 131,520,174 bp
  • A to G, chromosome 2 at 156,333,631 bp
  • A to G, chromosome 2 at 170,485,691 bp
  • A to T, chromosome 2 at 180,197,745 bp
  • G to A, chromosome 3 at 68,870,213 bp
  • G to T, chromosome 3 at 96,653,658 bp
  • T to A, chromosome 3 at 138,896,835 bp
  • A to G, chromosome 4 at 35,205,897 bp
  • T to A, chromosome 4 at 56,774,756 bp
  • C to G, chromosome 4 at 126,180,101 bp
  • T to C, chromosome 4 at 129,992,837 bp
  • T to C, chromosome 4 at 130,308,848 bp
  • T to C, chromosome 4 at 134,238,249 bp
  • C to T, chromosome 5 at 5,135,378 bp
  • A to G, chromosome 5 at 97,111,389 bp
  • G to T, chromosome 5 at 112,871,498 bp
  • A to G, chromosome 5 at 121,632,675 bp
  • A to G, chromosome 5 at 147,033,519 bp
  • A to G, chromosome 6 at 125,185,772 bp
  • T to G, chromosome 7 at 4,552,638 bp
  • T to C, chromosome 7 at 15,867,811 bp
  • C to T, chromosome 7 at 28,748,971 bp
  • C to A, chromosome 7 at 46,046,955 bp
  • T to C, chromosome 7 at 110,340,076 bp
  • A to G, chromosome 8 at 11,782,638 bp
  • G to T, chromosome 8 at 13,465,786 bp
  • G to T, chromosome 8 at 24,576,189 bp
  • T to C, chromosome 8 at 27,110,018 bp
  • T to C, chromosome 8 at 75,119,354 bp
  • A to T, chromosome 9 at 74,862,691 bp
  • G to A, chromosome 9 at 86,536,250 bp
  • A to C, chromosome 9 at 86,678,012 bp
  • A to G, chromosome 9 at 111,373,477 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • A to T, chromosome 10 at 79,035,504 bp
  • C to T, chromosome 10 at 80,060,492 bp
  • T to C, chromosome 10 at 116,113,616 bp
  • C to T, chromosome 11 at 5,521,975 bp
  • A to G, chromosome 11 at 55,282,010 bp
  • A to T, chromosome 11 at 58,666,077 bp
  • T to C, chromosome 12 at 4,658,452 bp
  • A to G, chromosome 12 at 25,005,088 bp
  • C to T, chromosome 12 at 112,023,253 bp
  • C to A, chromosome 13 at 21,703,226 bp
  • A to T, chromosome 14 at 20,464,615 bp
  • A to C, chromosome 14 at 52,450,442 bp
  • A to G, chromosome 14 at 122,944,826 bp
  • A to G, chromosome 15 at 3,968,965 bp
  • T to C, chromosome 15 at 35,642,436 bp
  • A to T, chromosome 15 at 101,545,153 bp
  • T to A, chromosome 16 at 21,766,408 bp
  • C to A, chromosome 16 at 32,755,501 bp
  • A to G, chromosome 17 at 57,441,353 bp
  • A to G, chromosome 17 at 66,150,385 bp
  • A to T, chromosome 17 at 83,588,339 bp
  • G to A, chromosome 18 at 13,015,898 bp
  • A to G, chromosome 18 at 34,808,731 bp
  • T to C, chromosome 19 at 6,907,558 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1601 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039638-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.