Strain Name:
C57BL/6J-MtgxR2180Btlr/Mmmh
Stock Number:
040182-MU
Citation ID:
RRID:MMRRC_040182-MU
Other Names:
R2180 (G1), C57BL/6J-MtgxR2180Btlr
Major Collection:

Strain Information

Rptor
Name: regulatory associated protein of MTOR, complex 1
Synonyms: raptor, 4932417H02Rik, Rap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74370
Homologene: 80210
Satb1
Name: special AT-rich sequence binding protein 1
Synonyms: 2610306G12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20230
Homologene: 2232
Trib2
Name: tribbles pseudokinase 2
Synonyms: TRB2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217410
Homologene: 41445
Enah
Name: ENAH actin regulator
Synonyms: Mena, Ndpp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13800
Homologene: 134005
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Fancd2
Name: Fanconi anemia, complementation group D2
Synonyms: 2410150O07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 211651
HGNC: HGNC:3585
Homologene: 13212
Ppp6c
Name: protein phosphatase 6, catalytic subunit
Synonyms: 2310003C10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67857
HGNC: HGNC:9323
Homologene: 68273
Sema4b
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
Synonyms: SemC, Semac
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20352
Homologene: 8426
Mapkapk5
Name: MAP kinase-activated protein kinase 5
Synonyms: PRAK, MK5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17165
HGNC: HGNC:6889
Homologene: 69077
Axin1
Name: axin 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12005
HGNC: HGNC:903
Homologene: 2614
Numa1
Name: nuclear mitotic apparatus protein 1
Synonyms: 6720401E04Rik, NuMA
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101706
HGNC: HGNC:8059
Homologene: 38150
Sin3b
Name: transcriptional regulator, SIN3B (yeast)
Synonyms: 2810430C10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20467
Homologene: 81810
Patj
Name: PATJ, crumbs cell polarity complex component
Synonyms: Cipp, Inadl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12695
Homologene: 72199
Helb
Name: helicase (DNA) B
Synonyms: D10Ertd664e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 117599
Homologene: 50463
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Cad
Name: carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms: 2410008J01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69719
HGNC: HGNC:1424
Homologene: 1412
Leo1
Name: Leo1, Paf1/RNA polymerase II complex component
Synonyms: LOC235497
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235497
VEGA: 9
Homologene: 133895
Smchd1
Name: SMC hinge domain containing 1
Synonyms: 4931400A14Rik, MommeD1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74355
Homologene: 23665
Ccnt1
Name: cyclin T1
Synonyms: CycT1, 2810478G24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12455
HGNC: HGNC:1599
Homologene: 947
Bdp1
Name: B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Synonyms: TFIIIB150, TFIIIB90, TAF3B1, TFC5, Tfnr, G630013P12Rik, B130055N23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544971
Homologene: 34582
Pfas
Name: phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)
Synonyms: 4432409B16Rik, Sofa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237823
HGNC: HGNC:8863
Homologene: 5970
Gigyf2
Name: GRB10 interacting GYF protein 2
Synonyms: A830080H02Rik, 2610016F01Rik, Tnrc15
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227331
Homologene: 41048
Zfp871
Name: zinc finger protein 871
Synonyms: 9030612M13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 208292
Homologene: 138401
Zfp738
Name: zinc finger protein 738
Synonyms: 6720487G11Rik, 3830402I07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 408068
Homologene: 133713
Adgrl4
Name: adhesion G protein-coupled receptor L4
Synonyms: EGF-TM7 receptor, Etl, 1110033N21Rik, Eltd1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170757
Homologene: 11170
Lrrtm1
Name: leucine rich repeat transmembrane neuronal 1
Synonyms: 4632401D06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74342
Homologene: 41763
Grik4
Name: glutamate receptor, ionotropic, kainate 4
Synonyms: KA1, 6330551K01Rik, GluRgamma1, KA-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110637
HGNC: HGNC:4582
Homologene: 81829
Rbl2
Name: RB transcriptional corepressor like 2
Synonyms: Rb2, p130, retinoblastoma-like 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19651
HGNC: HGNC:9894
Homologene: 4098
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Zfp266
Name: zinc finger protein 266
Synonyms: 5330440G10Rik, 5730601F06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77519
Homologene: 105676
Dhx29
Name: DExH-box helicase 29
Synonyms: E130202M19Rik, DEAH (Asp-Glu-Ala-His) box polypeptide 29
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218629
VEGA: 13
Homologene: 10387
Smcr8
Name: Smith-Magenis syndrome chromosome region, candidate 8 homolog (human)
Synonyms: D030073L15Rik, 2310076G09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237782
Homologene: 16989
Cep192
Name: centrosomal protein 192
Synonyms: D430014P18Rik, 4631422C13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70799
VEGA: 18
Homologene: 73526
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: calcium release channel isoform 1, Ryr, skrr
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20190
Homologene: 68069
Cars2
Name: cysteinyl-tRNA synthetase 2, mitochondrial
Synonyms: D530030H10Rik, 2310051N18Rik, 2410044A07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71941
Homologene: 11575
Anxa9
Name: annexin A9
Synonyms: 2310069F17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71790
HGNC: HGNC:547
Homologene: 2643
Itga2
Name: integrin alpha 2
Synonyms: VLA-2 receptor, alpha 2 subunit, CD49B, DX5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16398
VEGA: 13
HGNC: HGNC:6137
Homologene: 1662
Rap1gap2
Name: RAP1 GTPase activating protein 2
Synonyms: LOC380710, Garnl4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380711
Homologene: 56695
Ptpn13
Name: protein tyrosine phosphatase, non-receptor type 13
Synonyms: PTP-BL, Ptpri, PTPL1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19249
HGNC: HGNC:9646
Homologene: 7909
Sec14l2
Name: SEC14-like lipid binding 2
Synonyms: 1300013M05Rik, tap, Spf
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67815
Homologene: 8245
Helz2
Name: helicase with zinc finger 2, transcriptional coactivator
Synonyms: BC006779
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 229003
Homologene: 14118
Ptprh
Name: protein tyrosine phosphatase receptor type H
Synonyms: SAP-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545902
HGNC: HGNC:9672
Homologene: 37693
Scn5a
Name: sodium channel, voltage-gated, type V, alpha
Synonyms: Nav1.5c, Nav1.5, mH1, SkM2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20271
Homologene: 22738
Gm5800
Name: predicted gene 5800
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 545047
Homologene: 128452
Abca9
Name: ATP-binding cassette, sub-family A member 9
Synonyms: D630040K07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217262
HGNC: HGNC:39
Homologene: 33332
Ccdc150
Name: coiled-coil domain containing 150
Synonyms: 4930511H11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78016
Homologene: 15814
Or52e4
Name: olfactory receptor family 52 subfamily E member 4
Synonyms: GA_x6K02T2PBJ9-7685262-7686200, MOR32-11, Olfr677
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258355
Homologene: 81596
Asic1
Name: acid-sensing ion channel 1
Synonyms: BNaC2, ASIC, ASIC1a, ASICalpha, ASIC1 beta, B530003N02Rik, ASIC1b, Accn2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11419
VEGA: 15
HGNC: HGNC:100
Homologene: 121755
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Ppef2
Name: protein phosphatase, EF hand calcium-binding domain 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19023
HGNC: HGNC:9244
Homologene: 55959
Or10x1
Name: olfactory receptor family 10 subfamily X member 1
Synonyms: GA_x6K02T2P20D-20787051-20786119, MOR267-11, Olfr417
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258238
Homologene: 17358
Aox4
Name: aldehyde oxidase 4
Synonyms: AOH2, 2310003G12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71872
Homologene: 70273
Fggy
Name: FGGY carbohydrate kinase domain containing
Synonyms: 2310009E04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75578
Homologene: 49535
Niban1
Name: niban apoptosis regulator 1
Synonyms: Niban, Fam129a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 63913
Homologene: 62170
Ppp2r3a
Name: protein phosphatase 2, regulatory subunit B'', alpha
Synonyms: 3222402P14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235542
HGNC: HGNC:9307
Homologene: 20595
Tmc1
Name: transmembrane channel-like gene family 1
Synonyms: Bth, Beethoven, 4933416G09Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13409
VEGA: 19
Homologene: 23670
Spmip6
Name: sperm microtubule inner protein 6
Synonyms: Smrp1, Cbe1, 1110017D15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73721
Homologene: 13074
Caln1
Name: calneuron 1
Synonyms: 9630012C17Rik, Cabp8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 140904
Homologene: 10966
Atpaf1
Name: ATP synthase mitochondrial F1 complex assembly factor 1
Synonyms: ATP11, ATP11p, 6330547J17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230649
Homologene: 41492
Pom121l2
Name: POM121 transmembrane nucleoporin like 2
Synonyms: LOC195236
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 195236
Homologene: 123536
Hyou1
Name: hypoxia up-regulated 1
Synonyms: CBP-140, Orp150, 140 kDa, Grp170, Cab140
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12282
Homologene: 4658
Endov
Name: endonuclease V
Synonyms: A730011L01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 338371
Homologene: 15562
Adamts5
Name: ADAM metallopeptidase with thrombospondin type 1 motif 5
Synonyms: ADAM-TS5, 9530092O11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 23794
VEGA: 16
HGNC: HGNC:221
Homologene: 5109
Cd44
Name: CD44 antigen
Synonyms: Ly-24, Pgp-1, HERMES
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12505
HGNC: HGNC:1681
Homologene: 508
Ldhd
Name: lactate dehydrogenase D
Synonyms: D8Bwg1320e, 4733401P21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52815
Homologene: 5536
Gpr149
Name: G protein-coupled receptor 149
Synonyms: PGR10, 9630018L10Rik, Ieda, R35
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229357
Homologene: 16359
Or4f14b
Name: olfactory receptor family 4 subfamily F member 14B
Synonyms: GA_x6K02T2Q125-72988111-72987173, MOR245-19P, Olfr1307
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257956
Homologene: 128383
Btbd7
Name: BTB domain containing 7
Synonyms: FUP1, 5730507E09Rik, E130118E17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238386
VEGA: 12
Homologene: 34300
Gsg1
Name: germ cell associated 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14840
Homologene: 7745
Or2a12
Name: olfactory receptor family 2 subfamily A member 12
Synonyms: GA_x6K02T2P3E9-4632269-4631343, MOR261-12, Olfr446
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258292
Homologene: 17179
Rasgef1a
Name: RasGEF domain family, member 1A
Synonyms: 6330404M18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70727
Homologene: 17067
Msantd5l
Name: Myb/SANT DNA binding domain containing 5 like
Synonyms: BC049762
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 193286
Homologene: 77615
Gm13075
Name: predicted gene 13075
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 46,353,059 bp
  • G to A, chromosome 1 at 54,272,547 bp
  • A to T, chromosome 1 at 58,213,067 bp
  • G to A, chromosome 1 at 87,416,920 bp
  • A to T, chromosome 1 at 151,718,078 bp
  • A to G, chromosome 1 at 174,369,401 bp
  • A to T, chromosome 1 at 181,918,459 bp
  • T to C, chromosome 2 at 39,197,513 bp
  • C to T, chromosome 2 at 102,828,610 bp
  • A to G, chromosome 2 at 111,945,003 bp
  • A to T, chromosome 2 at 181,233,732 bp
  • A to G, chromosome 3 at 62,604,068 bp
  • T to C, chromosome 3 at 95,306,424 bp
  • A to T, chromosome 3 at 151,500,142 bp
  • T to A, chromosome 4 at 41,507,170 bp
  • T to A, chromosome 4 at 95,696,951 bp
  • G to A, chromosome 4 at 98,523,502 bp
  • T to C, chromosome 4 at 115,788,360 bp
  • G to T, chromosome 4 at 141,409,508 bp
  • T to C, chromosome 5 at 31,072,735 bp
  • G to A, chromosome 5 at 92,245,379 bp
  • T to G, chromosome 5 at 103,569,558 bp
  • T to C, chromosome 5 at 121,535,864 bp
  • T to C, chromosome 5 at 130,839,408 bp
  • C to T, chromosome 6 at 42,927,525 bp
  • A to G, chromosome 6 at 77,244,346 bp
  • A to T, chromosome 6 at 113,574,637 bp
  • A to T, chromosome 6 at 118,085,860 bp
  • A to T, chromosome 6 at 135,240,145 bp
  • T to A, chromosome 7 at 4,601,868 bp
  • G to A, chromosome 7 at 29,012,241 bp
  • A to G, chromosome 7 at 80,212,835 bp
  • T to C, chromosome 7 at 101,999,990 bp
  • T to C, chromosome 7 at 105,056,885 bp
  • C to T, chromosome 8 at 11,547,857 bp
  • T to A, chromosome 8 at 72,753,295 bp
  • T to C, chromosome 8 at 91,090,055 bp
  • T to C, chromosome 8 at 111,629,386 bp
  • A to T, chromosome 9 at 20,499,679 bp
  • A to T, chromosome 9 at 42,542,005 bp
  • A to T, chromosome 9 at 44,388,019 bp
  • G to A, chromosome 9 at 75,447,214 bp
  • A to T, chromosome 9 at 101,127,015 bp
  • A to G, chromosome 9 at 119,516,051 bp
  • A to G, chromosome 10 at 88,820,939 bp
  • G to A, chromosome 10 at 120,105,448 bp
  • C to T, chromosome 11 at 4,108,964 bp
  • C to A, chromosome 11 at 51,254,610 bp
  • T to G, chromosome 11 at 60,783,742 bp
  • T to C, chromosome 11 at 68,992,187 bp
  • T to C, chromosome 11 at 74,393,146 bp
  • C to T, chromosome 11 at 110,148,729 bp
  • T to A, chromosome 11 at 119,491,967 bp
  • T to A, chromosome 11 at 119,725,144 bp
  • A to T, chromosome 12 at 15,810,003 bp
  • A to T, chromosome 12 at 102,785,897 bp
  • A to G, chromosome 13 at 21,981,975 bp
  • G to A, chromosome 13 at 67,671,194 bp
  • ATTCTTCTTCTTCTTCTTC to ATTCTTCTTCTTCTTCTTCTTC, chromosome 13 at 100,061,405 bp
  • T to C, chromosome 13 at 112,962,872 bp
  • T to C, chromosome 13 at 114,849,381 bp
  • T to A, chromosome 14 at 51,715,994 bp
  • A to T, chromosome 15 at 98,543,600 bp
  • G to T, chromosome 15 at 99,671,965 bp
  • T to C, chromosome 16 at 85,887,924 bp
  • A to G, chromosome 17 at 26,143,335 bp
  • T to C, chromosome 17 at 30,840,647 bp
  • G to A, chromosome 17 at 32,775,301 bp
  • C to T, chromosome 17 at 51,803,496 bp
  • T to C, chromosome 17 at 71,378,267 bp
  • C to A, chromosome 17 at 71,463,799 bp
  • T to C, chromosome 17 at 74,612,151 bp
  • A to G, chromosome 18 at 67,824,742 bp
  • T to C, chromosome 19 at 20,824,084 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2180 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040182-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.