Strain Name:
C57BL/6J-MtgxR2247Btlr/Mmmh
Stock Number:
040247-MU
Citation ID:
RRID:MMRRC_040247-MU
Other Names:
R2247 (G1), C57BL/6J-MtgxR2247Btlr
Major Collection:

Strain Information

Jak2
Name: Janus kinase 2
Synonyms: C81284
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16452
VEGA: 19
HGNC: HGNC:6192
Homologene: 21033
Ranbp9
Name: RAN binding protein 9
Synonyms: IBAP-1, RanBPM
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56705
VEGA: 13
Homologene: 38057
Brd2
Name: bromodomain containing 2
Synonyms: Ring3, Frg-1, D17H6S113E, Fsrg1, Rnf3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14312
HGNC: HGNC:1103
Homologene: 74540
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: chromatin remodeling factor, 8030453L17Rik, E430018P19Rik, KMT2H
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 192195
Homologene: 10225
Sp2
Name: Sp2 transcription factor
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78912
Homologene: 2340
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: l(7)-3Rn, Ten-m4, Doc4, l7Rn3, ELM2, Odz4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23966
Homologene: 8034
Cspp1
Name: centrosome and spindle pole associated protein 1
Synonyms: 4930413O22Rik, 2310020J12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 211660
Homologene: 23487
Htt
Name: huntingtin
Synonyms: huntingtin, HD, htt, IT15, C430023I11Rik, Hdh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15194
HGNC: HGNC:4851
Homologene: 1593
Synrg
Name: synergin, gamma
Synonyms: L71-5, Ap1gbp1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217030
HGNC: HGNC:557
Homologene: 105680
Pwwp3a
Name: PWWP domain containing 3A, DNA repair factor
Synonyms: 9430059D04Rik, Mum1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68114
Homologene: 11349
Nol11
Name: nucleolar protein 11
Synonyms: 1500002M01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68979
Homologene: 32264
Pbrm1
Name: polybromo 1
Synonyms: BAF180, 2610016F04Rik, 2310032M22Rik, Pb1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66923
Homologene: 10044
Slc25a36
Name: solute carrier family 25, member 36
Synonyms: C330005L02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 192287
Homologene: 10039
Zfp236
Name: zinc finger protein 236
Synonyms: LOC240456
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 329002
Homologene: 7198
Bicra
Name: BRD4 interacting chromatin remodeling complex associated protein
Synonyms: Gltscr1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243842
HGNC: HGNC:4332
Homologene: 9250
Kcnab3
Name: potassium voltage-gated channel, shaker-related subfamily, beta member 3
Synonyms: mKv(beta)4, Kcnab4, C330022D06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16499
HGNC: HGNC:6230
Homologene: 55844
Mslnl
Name: mesothelin-like
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328783
VEGA: 17
Homologene: 18633
Mlkl
Name: mixed lineage kinase domain-like
Synonyms: 9130019I15Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74568
Homologene: 77416
Myh13
Name: myosin, heavy polypeptide 13, skeletal muscle
Synonyms: extraocular myosin, EO Myosin, MyHC-eo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 544791
HGNC: HGNC:7571
Homologene: 55780
Kctd18
Name: potassium channel tetramerisation domain containing 18
Synonyms: 4932411A20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 51960
Homologene: 12710
Hivep2
Name: human immunodeficiency virus type I enhancer binding protein 2
Synonyms: MIBP1, Schnurri-2, Shn-2, Gm20114
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15273
HGNC: HGNC:4921
Homologene: 4900
Myh11
Name: myosin, heavy polypeptide 11, smooth muscle
Synonyms: smMHC, SM2, SM1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17880
VEGA: 16
HGNC: HGNC:7569
Homologene: 128512
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Scart2
Name: scavenger receptor family member expressed on T cells 2
Synonyms: 5830411N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244234
Homologene: 133218
Slc4a11
Name: solute carrier family 4, sodium bicarbonate transporter-like, member 11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269356
Homologene: 12931
Or51ab3
Name: olfactory receptor family 51 subfamily AB member 3
Synonyms: GA_x6K02T2PBJ9-6275524-6276477, GA_x6K02T2PBJ9-6271959-6272393, MOR20-1, MOR20-1, Olfr614, Olfr613
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259104
Homologene: 17505
Impg2
Name: interphotoreceptor matrix proteoglycan 2
Synonyms: PG10.2, IPM200, Spacrcan
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224224
Homologene: 9439
Ephb1
Name: Eph receptor B1
Synonyms: Elk, Hek6, Net, Cek6, Elkh, C130099E04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270190
HGNC: HGNC:3392
Homologene: 20936
Rtl1
Name: retrotransposon Gaglike 1
Synonyms: Mart1, Mor1, Mar
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 353326
VEGA: 12
Homologene: 120261
Plcl2
Name: phospholipase C-like 2
Synonyms: Plce2, PRIP-2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224860
VEGA: 17
HGNC: HGNC:9064
Homologene: 9052
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Nin
Name: ninein
Synonyms: 3110068G20Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18080
Homologene: 40632
Psapl1
Name: prosaposin-like 1
Synonyms: 2310020A21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76943
Homologene: 105928
Acsbg3
Name: acyl-CoA synthetase bubblegum family member 3
Synonyms: 1700061G19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78625
Homologene: 28378
Raly
Name: hnRNP-associated with lethal yellow
Synonyms: Merc
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19383
Homologene: 7216
Dsc2
Name: desmocollin 2
Synonyms: Dsc2b, Dsc2a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13506
HGNC: HGNC:3036
Homologene: 8397
Pgap4
Name: post-GPI attachment to proteins GalNAc transferase 4
Synonyms: 9330170P15Rik, 2810432L12Rik, Tmem246
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67063
Homologene: 12080
Sult2b1
Name: sulfotransferase family, cytosolic, 2B, member 1
Synonyms: SULT2B, Gm5897
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54200
Homologene: 49487
Or10ab4
Name: olfactory receptor family 10 subfamily AB member 4
Synonyms: GA_x6K02T2PBJ9-10384085-10385068, MOR267-15, Olfr479
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257891
Homologene: 79346
AC120859.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Rptn
Name: repetin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20129
Homologene: 84780
Slc38a8
Name: solute carrier family 38, member 8
Synonyms: LOC234788
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234788
Homologene: 19028
Shisa3
Name: shisa family member 3
Synonyms: mShisa3, D830007B15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 330096
Homologene: 47831
Zfp189
Name: zinc finger protein 189
Synonyms: C430015I23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230162
Homologene: 20737
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 10,066,460 bp
  • A to G, chromosome 1 at 46,277,063 bp
  • A to T, chromosome 1 at 57,967,642 bp
  • A to T, chromosome 2 at 130,687,801 bp
  • A to G, chromosome 2 at 154,864,033 bp
  • A to T, chromosome 3 at 38,892,049 bp
  • C to A, chromosome 3 at 89,007,367 bp
  • A to G, chromosome 3 at 93,396,829 bp
  • T to A, chromosome 4 at 49,530,393 bp
  • T to C, chromosome 4 at 49,586,209 bp
  • A to T, chromosome 5 at 34,854,661 bp
  • A to G, chromosome 5 at 36,205,066 bp
  • G to A, chromosome 5 at 67,611,323 bp
  • C to A, chromosome 7 at 15,989,234 bp
  • A to T, chromosome 7 at 45,735,310 bp
  • T to A, chromosome 7 at 96,906,009 bp
  • T to A, chromosome 7 at 103,551,890 bp
  • C to T, chromosome 7 at 108,055,782 bp
  • G to A, chromosome 7 at 140,249,129 bp
  • G to A, chromosome 8 at 111,322,809 bp
  • A to G, chromosome 8 at 119,485,650 bp
  • A to T, chromosome 9 at 97,100,138 bp
  • A to T, chromosome 9 at 101,996,811 bp
  • C to A, chromosome 10 at 14,128,969 bp
  • A to G, chromosome 10 at 80,240,425 bp
  • A to T, chromosome 11 at 67,334,558 bp
  • A to G, chromosome 11 at 69,330,190 bp
  • T to C, chromosome 11 at 84,009,376 bp
  • A to C, chromosome 11 at 96,962,018 bp
  • A to T, chromosome 11 at 107,180,123 bp
  • T to C, chromosome 12 at 70,054,545 bp
  • T to C, chromosome 12 at 109,594,979 bp
  • T to C, chromosome 13 at 43,412,425 bp
  • A to G, chromosome 14 at 31,074,893 bp
  • A to G, chromosome 16 at 14,277,559 bp
  • A to G, chromosome 16 at 56,268,264 bp
  • G to A, chromosome 17 at 25,742,934 bp
  • A to G, chromosome 17 at 34,114,415 bp
  • T to C, chromosome 17 at 50,606,845 bp
  • A to G, chromosome 17 at 56,877,435 bp
  • T to A, chromosome 18 at 20,035,312 bp
  • ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC to ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC, chromosome 18 at 50,046,845 bp
  • A to G, chromosome 18 at 82,604,298 bp
  • T to C, chromosome 19 at 29,283,636 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2247 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040247-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.