Strain Name:
C57BL/6J-MtgxR3023Btlr/Mmmh
Stock Number:
040539-MU
Citation ID:
RRID:MMRRC_040539-MU
Other Names:
R3023 (G1), C57BL/6J-MtgxR3023Btlr
Major Collection:

Strain Information

Epb41l1
Name: erythrocyte membrane protein band 4.1 like 1
Synonyms: 4.1N, Epb4.1l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13821
HGNC: HGNC:3378
Homologene: 8126
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: IGF-1R, A330103N21Rik, hyft, CD221, line 186
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Fxr1
Name: FMR1 autosomal homolog 1
Synonyms: 9530073J07Rik, Fxr1h, 1110050J02Rik, Fxr1p
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14359
HGNC: HGNC:4023
Homologene: 3573
Tlr2
Name: toll-like receptor 2
Synonyms: Ly105
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 24088
Homologene: 20695
Tshr
Name: thyroid stimulating hormone receptor
Synonyms: hyt, hypothroid, pet
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22095
Homologene: 315
Arl5a
Name: ADP-ribosylation factor-like 5A
Synonyms: Arl5, 2810410P22Rik, 2410015N24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75423
HGNC: HGNC:696
Homologene: 100572
Cc2d2a
Name: coiled-coil and C2 domain containing 2A
Synonyms: 5730509K17Rik, b2b1035Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231214
Homologene: 18159
Slc12a7
Name: solute carrier family 12, member 7
Synonyms: Kcc4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20499
VEGA: 13
Homologene: 21312
Ckap2
Name: cytoskeleton associated protein 2
Synonyms: LB1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 80986
HGNC: HGNC:1990
Homologene: 10070
Plekhm3
Name: pleckstrin homology domain containing, family M, member 3
Synonyms: A230102O09Rik, 9430067K14Rik, Plekhm1l
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241075
Homologene: 18459
Plcd4
Name: phospholipase C, delta 4
Synonyms: 4921507K24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18802
HGNC: HGNC:9062
Homologene: 88782
Or4a78
Name: olfactory receptor family 4 subfamily A member 78
Synonyms: GA_x6K02T2Q125-51109312-51108356, Olfr1251, MOR231-24_p, MOR231-15P
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259145
Homologene: 74065
Abca15
Name: ATP-binding cassette, sub-family A member 15
Synonyms: 4930500I12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320631
Homologene: 87255
Pwwp2b
Name: PWWP domain containing 2B
Synonyms: D930023J19Rik, D7Ertd517e, Pwwp2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101631
Homologene: 19056
Vmn2r78
Name: vomeronasal 2, receptor 78
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637896
Homologene: 115466
A2m
Name: alpha-2-macroglobulin
Synonyms: A2mp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232345
HGNC: HGNC:7
Homologene: 37248
Rp1
Name: retinitis pigmentosa 1 (human)
Synonyms: Rp1h, mG145, oxygen-regulated protein 1, Dcdc3, Orp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19888
Homologene: 4564
Osbpl6
Name: oxysterol binding protein-like 6
Synonyms: 1110062M20Rik, ORP-6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99031
Homologene: 101447
Vmn2r18
Name: vomeronasal 2, receptor 18
Synonyms: EG632671
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 632671
Atp8b5
Name: ATPase, class I, type 8B, member 5
Synonyms: FetA, 4930417M19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320571
Homologene: 99882
Kif26b
Name: kinesin family member 26B
Synonyms: N-11 kinesin, D230039L06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269152
Homologene: 18623
Sdk1
Name: sidekick cell adhesion molecule 1
Synonyms: 6720466O15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330222
Homologene: 27395
Doc2b
Name: double C2, beta
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13447
HGNC: HGNC:2986
Homologene: 20796
Sstr3
Name: somatostatin receptor 3
Synonyms: Smstr3, Smstr-3, sst3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20607
VEGA: 15
Homologene: 20285
Tmem25
Name: transmembrane protein 25
Synonyms: 0610039J01Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71687
Homologene: 12403
Dtx3l
Name: deltex 3-like, E3 ubiquitin ligase
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 209200
Homologene: 51375
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 4,352,675 bp
  • CCTGCTGCTGCTGCTGCTGCTGCTGC to CCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 64,937,781 bp
  • A to G, chromosome 1 at 74,548,192 bp
  • G to A, chromosome 1 at 178,864,868 bp
  • A to G, chromosome 2 at 52,416,197 bp
  • A to T, chromosome 2 at 76,586,733 bp
  • A to G, chromosome 2 at 89,667,646 bp
  • A to C, chromosome 2 at 156,514,209 bp
  • G to A, chromosome 3 at 34,064,224 bp
  • C to T, chromosome 3 at 83,837,871 bp
  • A to G, chromosome 4 at 43,311,957 bp
  • T to A, chromosome 5 at 43,685,251 bp
  • C to G, chromosome 5 at 142,046,236 bp
  • T to C, chromosome 5 at 151,561,683 bp
  • A to T, chromosome 6 at 121,669,572 bp
  • A to G, chromosome 7 at 68,183,399 bp
  • G to T, chromosome 7 at 86,954,966 bp
  • A to T, chromosome 7 at 120,382,779 bp
  • G to A, chromosome 7 at 139,256,194 bp
  • T to C, chromosome 8 at 22,175,861 bp
  • A to G, chromosome 9 at 44,795,675 bp
  • G to A, chromosome 11 at 75,772,625 bp
  • A to G, chromosome 12 at 91,533,880 bp
  • T to A, chromosome 13 at 73,800,422 bp
  • G to A, chromosome 15 at 78,539,987 bp
  • A to G, chromosome 16 at 35,932,436 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3023 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040539-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.