Strain Name:
C57BL/6J-MtgxR3040Btlr/Mmmh
Stock Number:
040556-MU
Citation ID:
RRID:MMRRC_040556-MU
Other Names:
R3040 (G1), C57BL/6J-MtgxR3040Btlr
Major Collection:

Strain Information

Nedd4
Name: neural precursor cell expressed, developmentally down-regulated 4
Synonyms: Nedd4-1, Nedd4, Nedd4a, E430025J12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17999
HGNC: HGNC:7727
Homologene: 134533
Ccar1
Name: cell division cycle and apoptosis regulator 1
Synonyms: Carp1, 2610511G16Rik, 9430036H15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67500
VEGA: 10
Homologene: 10086
Trip12
Name: thyroid hormone receptor interactor 12
Synonyms: Gtl6, 1110036I07Rik, 6720416K24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14897
Homologene: 44226
Myo9b
Name: myosin IXb
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17925
HGNC: HGNC:7609
Homologene: 3058
Amotl1
Name: angiomotin-like 1
Synonyms: 4932416D09Rik, JEAP, 2310010G08Rik, 2310067L22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75723
Homologene: 43977
Neurl1a
Name: neuralized E3 ubiquitin protein ligase 1A
Synonyms: Nlz, 2410129E16Rik, Neu1, Rnf67, Neur1, Neurl
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18011
VEGA: 19
HGNC: HGNC:7761
Homologene: 32503
Slf2
Name: SMC5-SMC6 complex localization factor 2
Synonyms: 6030443O07Rik, Fam178a
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226151
VEGA: 19
Homologene: 23077
Dzip3
Name: DAZ interacting protein 3, zinc finger
Synonyms: 6430549P11Rik, 2310047C04Rik, 2A-HUB
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224170
Homologene: 8771
Gask1b
Name: golgi associated kinase 1B
Synonyms: 2210419I08Rik, Ened, 1110032E23Rik, Fam198b
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68659
Homologene: 9590
Ampd2
Name: adenosine monophosphate deaminase 2
Synonyms: Ampd-2, 1200014F01Rik, m4521Dajl
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109674
HGNC: HGNC:469
Homologene: 2979
Psmd2
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
Synonyms: TEG-190, Tex190, 9430095H01Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21762
HGNC: HGNC:9559
Homologene: 2101
Gdap2
Name: ganglioside-induced differentiation-associated-protein 2
Synonyms: D3Ertd801e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14547
Homologene: 7728
Luc7l
Name: Luc7-like
Synonyms: 2410018D03Rik, 1810045C04Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66978
HGNC: HGNC:6723
Homologene: 100558
Prickle1
Name: prickle planar cell polarity protein 1
Synonyms: 1110058P22Rik, mpk1, b2b019Clo, Pk1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 106042
Homologene: 17686
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329178
Homologene: 122243
Fbn2
Name: fibrillin 2
Synonyms: sy, Sne, Fib-2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14119
VEGA: 18
HGNC: HGNC:3604
Homologene: 1515
Cyp2c50
Name: cytochrome P450, family 2, subfamily c, polypeptide 50
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107141
Homologene: 137231
Agxt2
Name: alanine-glyoxylate aminotransferase 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268782
Homologene: 12887
Etfdh
Name: electron transferring flavoprotein, dehydrogenase
Synonyms: 0610010I20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66841
HGNC: HGNC:3483
Homologene: 3275
Isg20l2
Name: interferon stimulated exonuclease gene 20-like 2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229504
Homologene: 12814
Gm2042
Name: predicted gene 2042
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100039087
Homologene: 103830
Pyroxd2
Name: pyridine nucleotide-disulphide oxidoreductase domain 2
Synonyms: 3830409H07Rik, 4833409A17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74580
VEGA: 19
Homologene: 13097
Kcna7
Name: potassium voltage-gated channel, shaker-related subfamily, member 7
Synonyms: Kv1.7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16495
HGNC: HGNC:6226
Homologene: 7791
Bahd1
Name: bromo adjacent homology domain containing 1
Synonyms: LOC228536
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228536
Homologene: 8976
Mepe
Name: matrix extracellular phosphoglycoprotein with ASARM motif (bone)
Synonyms: OF45
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 94111
Homologene: 10623
Dcdc2c
Name: doublecortin domain containing 2C
Synonyms: 1110015M06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68511
Homologene: 131934
Styxl1
Name: serine/threonine/tyrosine interacting-like 1
Synonyms: 1700011C14Rik, Dusp24
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76571
Homologene: 9378
Vmn1r122
Name: vomeronasal 1 receptor 122
Synonyms: Gm5729
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 435951
Homologene: 104166
Tmem70
Name: transmembrane protein 70
Synonyms: 2210416J16Rik, 1110020A09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70397
Homologene: 9890
Iqcj
Name: IQ motif containing J
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 208426
Homologene: 132095
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 16,667,765 bp
  • G to A, chromosome 1 at 66,639,305 bp
  • A to G, chromosome 1 at 84,742,245 bp
  • C to T, chromosome 2 at 118,916,406 bp
  • T to C, chromosome 3 at 68,055,342 bp
  • C to T, chromosome 3 at 79,604,919 bp
  • T to A, chromosome 3 at 79,887,125 bp
  • T to C, chromosome 3 at 87,931,995 bp
  • T to C, chromosome 3 at 100,188,035 bp
  • A to G, chromosome 3 at 108,076,416 bp
  • T to G, chromosome 5 at 104,338,122 bp
  • C to T, chromosome 5 at 135,757,033 bp
  • G to C, chromosome 7 at 21,133,446 bp
  • GGCTGCGCGGTGCCGCCCGAGCGGCCGCTGC to GGCTGC, chromosome 7 at 45,406,788 bp
  • G to A, chromosome 8 at 71,334,337 bp
  • A to C, chromosome 9 at 14,572,773 bp
  • T to C, chromosome 9 at 72,669,961 bp
  • G to T, chromosome 10 at 62,756,494 bp
  • G to C, chromosome 12 at 28,552,182 bp
  • A to T, chromosome 12 at 88,178,348 bp
  • A to G, chromosome 15 at 10,371,693 bp
  • A to G, chromosome 15 at 93,509,370 bp
  • T to C, chromosome 16 at 20,657,567 bp
  • G to A, chromosome 16 at 48,928,324 bp
  • A to T, chromosome 17 at 26,277,619 bp
  • A to T, chromosome 18 at 58,093,387 bp
  • A to G, chromosome 19 at 40,098,126 bp
  • G to T, chromosome 19 at 42,735,518 bp
  • A to G, chromosome 19 at 44,980,569 bp
  • T to C, chromosome 19 at 47,239,831 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3040 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040556-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.