Strain Name:
C57BL/6J-MtgxR3771Btlr/Mmmh
Stock Number:
040747-MU
Citation ID:
RRID:MMRRC_040747-MU
Other Names:
R3771 (G1), C57BL/6J-MtgxR3771Btlr
Major Collection:

Strain Information

Lrrn3
Name: leucine rich repeat protein 3, neuronal
Synonyms: NLRR-3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16981
VEGA: 12
Homologene: 36315
Elf1
Name: E74 like ETS transcription factor 1
Synonyms: Elf-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13709
VEGA: 14
HGNC: HGNC:3316
Homologene: 7303
Kdm5b
Name: lysine demethylase 5B
Synonyms: Rb-Bp2, 2210016I17Rik, Jarid1b, 2010009J12Rik, D1Ertd202e, Plu1, PLU-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Abcc8
Name: ATP-binding cassette, sub-family C member 8
Synonyms: Sur, SUR1, D930031B21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20927
HGNC: HGNC:59
Homologene: 68048
Lrp5
Name: low density lipoprotein receptor-related protein 5
Synonyms: LRP7, LR3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16973
Homologene: 1746
Kat6b
Name: K(lysine) acetyltransferase 6B
Synonyms: Myst4, Morf, monocytic leukemia, qkf, querkopf, B130044K16Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54169
Homologene: 136480
Ascc3
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: B630009I04Rik, Helic1, ASC1p200
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77987
VEGA: 10
Homologene: 4973
Srebf2
Name: sterol regulatory element binding factor 2
Synonyms: SREBP2gc, nuc, SREBP2, bHLHd2, lop13, SREBP-2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20788
VEGA: 15
Homologene: 20966
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: D630005A10Rik, apollon, A430032G04Rik, A430040A19Rik, Bruce
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Xrn2
Name: 5'-3' exoribonuclease 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 24128
Homologene: 6927
Tnpo2
Name: transportin 2 (importin 3, karyopherin beta 2b)
Synonyms: TRN2, 1110034O24Rik, Kpnb2b
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212999
Homologene: 8381
Tex2
Name: testis expressed gene 2
Synonyms: Taz4, 4930568E07Rik, Def-5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21763
Homologene: 32414
Ttk
Name: Ttk protein kinase
Synonyms: Esk1, Mps1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22137
Homologene: 2489
Vps39
Name: VPS39 HOPS complex subunit
Synonyms: A230065P22Rik, Vam6P, Vam6, mVam6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269338
Homologene: 41025
Rnf39
Name: ring finger protein 39
Synonyms: LOC386465, LOC386454, LIRF, LOC240094
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 386454
Homologene: 11891
Polr3c
Name: polymerase (RNA) III (DNA directed) polypeptide C
Synonyms: RPC62, 4933407E01Rik, RPC3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74414
Homologene: 38185
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: 6720464I07Rik, Solo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223435
VEGA: 15
Homologene: 20847
Numb
Name: NUMB endocytic adaptor protein
Synonyms: m-numb
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18222
HGNC: HGNC:8060
Homologene: 2775
Shisal1
Name: shisa like 1
Synonyms: 1810041L15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72301
Homologene: 28255
Acsl5
Name: acyl-CoA synthetase long-chain family member 5
Synonyms: 1700030F05Rik, Facl5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 433256
VEGA: 19
Homologene: 69208
Igf2r
Name: insulin-like growth factor 2 receptor
Synonyms: M6P/IGF2R, mannose-6-phosphate receptor, cation independent, CD222, CI-MPR, Mpr300, IGF-II/CI-MPR
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16004
HGNC: HGNC:5467
Homologene: 676
Ptprs
Name: protein tyrosine phosphatase receptor type S
Synonyms: PTP-NU3, Ptpt9, RPTPsigma, PTPsigma
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19280
HGNC: HGNC:9681
Homologene: 20626
Riok2
Name: RIO kinase 2
Synonyms: 2410085M17Rik, 2010110K24Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67045
VEGA: 17
Homologene: 6760
Med23
Name: mediator complex subunit 23
Synonyms: X83317, ESTM7, sno, Crsp3, Sur2, 3000002A17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70208
HGNC: HGNC:2372
Homologene: 3552
Ska3
Name: spindle and kinetochore associated complex subunit 3
Synonyms: F630043A04Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219114
VEGA: 14
Homologene: 124284
Kcnab3
Name: potassium voltage-gated channel, shaker-related subfamily, beta member 3
Synonyms: Kcnab4, mKv(beta)4, C330022D06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16499
HGNC: HGNC:6230
Homologene: 55844
Ank1
Name: ankyrin 1, erythroid
Synonyms: pale, Ank-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11733
HGNC: HGNC:492
Homologene: 55427
Hmcn2
Name: hemicentin 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 665700
Homologene: 90772
Ttn
Name: titin
Synonyms: shru, L56, mdm, connectin, D330041I19Rik, 2310057K23Rik, 2310074I15Rik, 2310036G12Rik, D830007G01Rik, 1100001C23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Pico, Acz
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Tecta
Name: tectorin alpha
Synonyms: Tctna, [a]-tectorin
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21683
Homologene: 3955
Zfp251
Name: zinc finger protein 251
Synonyms: 9130001M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71591
VEGA: 15
Homologene: 87789
Ugcg
Name: UDP-glucose ceramide glucosyltransferase
Synonyms: Ugcgl, GlcT-1, Epcs21
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22234
Homologene: 37763
Dpyd
Name: dihydropyrimidine dehydrogenase
Synonyms: E330028L06Rik, DPD
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99586
HGNC: HGNC:3012
Homologene: 85
Man2c1
Name: mannosidase, alpha, class 2C, member 1
Synonyms: 1110025H24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73744
HGNC: HGNC:6827
Homologene: 4887
Rin2
Name: Ras and Rab interactor 2
Synonyms: 4632403N06Rik, RASSF4, 2010003K16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74030
Homologene: 32430
Abcb11
Name: ATP-binding cassette, sub-family B member 11
Synonyms: ABC16, Lith1, PFIC2, sister of P-glycoprotein, Bsep, PGY4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27413
HGNC: HGNC:42
Homologene: 74509
Scn9a
Name: sodium channel, voltage-gated, type IX, alpha
Synonyms: PN1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20274
Homologene: 2237
Cdh12
Name: cadherin 12
Synonyms: Br-cadherin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 215654
HGNC: HGNC:1751
Homologene: 37873
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235505
Homologene: 25183
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Slc4a10
Name: solute carrier family 4, sodium bicarbonate cotransporter-like, member 10
Synonyms: NCBE
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94229
Homologene: 23340
Aoc1l2
Name: amine oxidase copper containing 1-like 2
Synonyms: 1600015I10Rik, Doxl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 69761
HGNC: HGNC:80
Homologene: 79726
Sun1
Name: Sad1 and UNC84 domain containing 1
Synonyms: 4632417G13Rik, Unc84a, 5730434D03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77053
Homologene: 11544
Armc2
Name: armadillo repeat containing 2
Synonyms: 2610018I05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 213402
Homologene: 41848
Zfp426
Name: zinc finger protein 426
Synonyms: Zfo61, KRAB1, 2900057C04Rik, Zfp68-rs1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235028
Homologene: 23435
Adam26b
Name: a disintegrin and metallopeptidase domain 26B
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382007
Homologene: 128363
Vmn1r60
Name: vomeronasal 1 receptor 60
Synonyms: Gm7184
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 636697
Homologene: 41799
Fap
Name: fibroblast activation protein
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14089
HGNC: HGNC:3590
Homologene: 48282
Ogg1
Name: 8-oxoguanine DNA-glycosylase 1
Synonyms: Mmh
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18294
HGNC: HGNC:8125
Homologene: 1909
Fbxo39
Name: F-box protein 39
Synonyms: 1700010H23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 628100
Homologene: 15156
Or6c69c
Name: olfactory receptor family 6 subfamily C member 69C
Synonyms: Olfr822, GA_x6K02T2PULF-11745102-11746040, MOR113-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258666
Homologene: 133890
Pnpt1
Name: polyribonucleotide nucleotidyltransferase 1
Synonyms: PNPase, polynucleotide phosphorylase, 1200003F12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71701
Homologene: 12404
Fmn1
Name: formin 1
Synonyms: Fmn, formin-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14260
HGNC: HGNC:3768
Homologene: 121778
Fam13a
Name: family with sequence similarity 13, member A
Synonyms: D430015B01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58909
Homologene: 135847
Vmn2r101
Name: vomeronasal 2, receptor 101
Synonyms: EG627576
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627576
Homologene: 115024
Rwdd2a
Name: RWD domain containing 2A
Synonyms: 1700030C20Rik, Rwdd2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 69519
Homologene: 12315
Vmn1r71
Name: vomeronasal 1 receptor 71
Synonyms: V1re13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 252910
Homologene: 74352
Usp16
Name: ubiquitin specific peptidase 16
Synonyms: 1200004E02Rik, UBP-M, 2810483I07Rik, 6330514E22Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74112
Homologene: 38183
Cxcr6
Name: C-X-C motif chemokine receptor 6
Synonyms: BONZO, STRL33
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 80901
VEGA: 9
Homologene: 38197
Ddx19b
Name: DEAD box helicase 19b
Synonyms: 2810457M08Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 19b, 4921519L13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234733
HGNC: HGNC:2742
Homologene: 56032
Tc2n
Name: tandem C2 domains, nuclear
Synonyms: Mtac2d1, Tac2-N, 4933406D09Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74413
Homologene: 12560
Dagla
Name: diacylglycerol lipase, alpha
Synonyms: Nsddr
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 269060
HGNC: HGNC:1165
Homologene: 4468
Or1o2
Name: olfactory receptor family 1 subfamily O member 2
Synonyms: Olfr97, MOR156-2, GA_x6K02T2PSCP-1672287-1671355
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258505
Homologene: 133051
Clstn2
Name: calsyntenin 2
Synonyms: Cst-2, CSTN2, CS2, 2900042C18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 64085
Homologene: 49698
Nhlrc4
Name: NHL repeat containing 4
Synonyms: F430201B04Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 621239
Homologene: 134625
Zfp61
Name: zinc finger protein 61
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22719
Homologene: 74923
Aanat
Name: arylalkylamine N-acetyltransferase
Synonyms: Nat-2, SNAT, Nat4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11298
HGNC: HGNC:19
Homologene: 31013
Cbarp
Name: calcium channel, voltage-dependent, beta subunit associated regulatory protein
Synonyms: R29144/1, Dos
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100503659
Homologene: 82309
AC120128.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Irf2bp2
Name: interferon regulatory factor 2 binding protein 2
Synonyms: E130305N23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270110
Homologene: 34290
Gm867
Name: predicted gene 867
Synonyms: LOC327769, LOC333670
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 333670
Homologene: 122921
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 134,613,345 bp
  • C to T, chromosome 2 at 31,360,896 bp
  • T to C, chromosome 2 at 62,263,943 bp
  • C to A, chromosome 2 at 62,533,010 bp
  • T to C, chromosome 2 at 66,483,648 bp
  • T to A, chromosome 2 at 69,329,376 bp
  • T to C, chromosome 2 at 76,771,367 bp
  • T to G, chromosome 2 at 113,582,118 bp
  • C to T, chromosome 2 at 120,342,016 bp
  • C to T, chromosome 2 at 145,860,446 bp
  • T to C, chromosome 2 at 147,061,287 bp
  • T to G, chromosome 3 at 90,119,894 bp
  • T to A, chromosome 3 at 96,725,854 bp
  • G to A, chromosome 3 at 119,412,278 bp
  • T to C, chromosome 4 at 59,189,690 bp
  • A to T, chromosome 5 at 14,539,408 bp
  • T to C, chromosome 5 at 52,582,746 bp
  • A to G, chromosome 5 at 139,238,820 bp
  • T to C, chromosome 6 at 48,931,196 bp
  • T to G, chromosome 6 at 58,987,186 bp
  • T to C, chromosome 6 at 113,333,843 bp
  • C to A, chromosome 7 at 5,544,711 bp
  • T to C, chromosome 7 at 10,747,837 bp
  • T to C, chromosome 7 at 24,295,981 bp
  • A to G, chromosome 7 at 46,151,685 bp
  • T to C, chromosome 8 at 23,123,897 bp
  • T to A, chromosome 8 at 43,520,714 bp
  • T to A, chromosome 8 at 85,044,746 bp
  • T to C, chromosome 8 at 111,020,981 bp
  • T to C, chromosome 8 at 126,591,811 bp
  • A to T, chromosome 9 at 20,473,117 bp
  • T to C, chromosome 9 at 42,330,996 bp
  • C to A, chromosome 9 at 57,140,377 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • A to T, chromosome 9 at 83,844,036 bp
  • A to C, chromosome 9 at 86,574,161 bp
  • A to G, chromosome 9 at 97,582,562 bp
  • A to G, chromosome 9 at 123,810,485 bp
  • G to T, chromosome 10 at 24,902,201 bp
  • C to T, chromosome 10 at 41,922,227 bp
  • C to T, chromosome 10 at 50,720,718 bp
  • G to T, chromosome 10 at 52,128,991 bp
  • A to T, chromosome 10 at 75,939,966 bp
  • A to T, chromosome 10 at 80,136,692 bp
  • A to G, chromosome 10 at 130,075,274 bp
  • T to C, chromosome 11 at 29,138,174 bp
  • A to G, chromosome 11 at 69,328,563 bp
  • T to C, chromosome 11 at 72,317,215 bp
  • T to C, chromosome 11 at 106,546,894 bp
  • G to T, chromosome 11 at 116,596,871 bp
  • T to A, chromosome 12 at 41,452,870 bp
  • T to C, chromosome 12 at 83,799,576 bp
  • T to A, chromosome 12 at 101,694,574 bp
  • A to G, chromosome 14 at 21,517,098 bp
  • C to T, chromosome 14 at 57,810,077 bp
  • T to C, chromosome 14 at 79,567,210 bp
  • A to T, chromosome 15 at 21,578,554 bp
  • A to G, chromosome 15 at 27,748,091 bp
  • A to G, chromosome 15 at 76,853,636 bp
  • A to G, chromosome 15 at 82,182,108 bp
  • A to T, chromosome 15 at 84,406,685 bp
  • T to C, chromosome 16 at 87,458,683 bp
  • A to G, chromosome 17 at 12,701,205 bp
  • A to G, chromosome 17 at 17,374,651 bp
  • A to G, chromosome 17 at 19,589,657 bp
  • T to A, chromosome 17 at 25,943,393 bp
  • T to C, chromosome 17 at 36,947,229 bp
  • T to A, chromosome 17 at 37,231,465 bp
  • T to C, chromosome 17 at 56,428,978 bp
  • T to A, chromosome 17 at 74,618,429 bp
  • G to A, chromosome 19 at 3,612,330 bp
  • G to A, chromosome 19 at 10,248,467 bp
  • G to A, chromosome 19 at 55,283,399 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3771 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040747-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.