Strain Name:
C57BL/6J-MtgxR3839Btlr/Mmmh
Stock Number:
040892-MU
Citation ID:
RRID:MMRRC_040892-MU
Other Names:
R3839 (G1), C57BL/6J-MtgxR3839Btlr
Major Collection:

Strain Information

Gldc
Name: glycine decarboxylase
Synonyms: D030049L12Rik, b2b2679Clo, D19Wsu57e
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104174
VEGA: 19
HGNC: HGNC:4313
Homologene: 141
Slit3
Name: slit guidance ligand 3
Synonyms: b2b2362.1Clo, Slit1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20564
Homologene: 2303
Nap1l1
Name: nucleosome assembly protein 1-like 1
Synonyms: D10Ertd68e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 53605
VEGA: 10
HGNC: HGNC:7637
Homologene: 129218
Senp2
Name: SUMO/sentrin specific peptidase 2
Synonyms: 4930538C18Rik, 2310007L05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 75826
VEGA: 16
Homologene: 11005
Hmgcr
Name: 3-hydroxy-3-methylglutaryl-Coenzyme A reductase
Synonyms: Red, 3-hydroxy-3-methylglutaryl-CoA reductase, HMG-CoAR
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15357
HGNC: HGNC:5006
Homologene: 30994
Usp14
Name: ubiquitin specific peptidase 14
Synonyms: nmf375, 2610037B11Rik, NMF375, ax, 2610005K12Rik, dUB-type TGT, ataxia
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 59025
Homologene: 3780
Ddx56
Name: DEAD box helicase 56
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 56, NOH61, 2600001H07Rik, D11Ertd619e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52513
Homologene: 6498
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, MCPH5, D330028K02Rik, Aspm, Calmbp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12316
Homologene: 7650
Cc2d2a
Name: coiled-coil and C2 domain containing 2A
Synonyms: 5730509K17Rik, b2b1035Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231214
Homologene: 18159
Cald1
Name: caldesmon 1
Synonyms: C920027I18Rik, 4833423D12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109624
HGNC: HGNC:1441
Homologene: 137254
Msn
Name: moesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 17698
HGNC: HGNC:7373
Homologene: 1833
Ackr3
Name: atypical chemokine receptor 3
Synonyms: Rdc1, Cxcr7, Cmkor1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12778
Homologene: 22419
Rala
Name: v-ral simian leukemia viral oncogene A (ras related)
Synonyms: 3010001O15Rik, Ral, Rasl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 56044
HGNC: HGNC:9839
Homologene: 3942
Eif3d
Name: eukaryotic translation initiation factor 3, subunit D
Synonyms: mouse translation initiation factor eIF3 p66, eIF3p66, 66/67kDa, Eif3s7
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 55944
VEGA: 15
HGNC: HGNC:3278
Homologene: 2782
Rps9
Name: ribosomal protein S9
Synonyms: 3010033P07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76846
Homologene: 68145
Cdh9
Name: cadherin 9
Synonyms: T1-cadherin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12565
HGNC: HGNC:1768
Homologene: 9450
Lama1
Name: laminin, alpha 1
Synonyms: Lama
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16772
VEGA: 17
HGNC: HGNC:6481
Homologene: 21146
Fam13c
Name: family with sequence similarity 13, member C
Synonyms: C030038O19Rik, 1200015N20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71721
Homologene: 11490
Dnajb2
Name: DnaJ heat shock protein family (Hsp40) member B2
Synonyms: Dnajb10, mDj8, 2700059H22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56812
HGNC: HGNC:5228
Homologene: 4902
Garnl3
Name: GTPase activating RANGAP domain-like 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99326
Homologene: 13003
Skor1
Name: SKI family transcriptional corepressor 1
Synonyms: Corl1, Lbxcor1, C230094B15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 207667
Homologene: 18175
Ctnnd2
Name: catenin delta 2
Synonyms: Nprap, catenin (cadherin associated protein), delta 2, Catnd2, neurojugin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18163
VEGA: 15
HGNC: HGNC:2516
Homologene: 55574
Col9a2
Name: collagen, type IX, alpha 2
Synonyms: Col9a-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12840
HGNC: HGNC:2218
Homologene: 37535
Hivep2
Name: human immunodeficiency virus type I enhancer binding protein 2
Synonyms: Schnurri-2, MIBP1, Gm20114, Shn-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15273
HGNC: HGNC:4921
Homologene: 4900
Cyp4a10
Name: cytochrome P450, family 4, subfamily a, polypeptide 10
Synonyms: D4Rp1, Cyp4a, Msp-3, RP1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13117
HGNC: HGNC:2642
Homologene: 128044
Itih1
Name: inter-alpha trypsin inhibitor, heavy chain 1
Synonyms: Intin1, Itih-1, inter-alpha (globulin) inhibitor, H1 polypeptide
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16424
HGNC: HGNC:6166
Homologene: 1667
Zfp108
Name: zinc finger protein 108
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54678
Homologene: 117959
Abraxas2
Name: BRISC complex subunit
Synonyms: KIAA0157, C430003P19Rik, Fam175b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 109359
Homologene: 12970
AW551984
Name: expressed sequence AW551984
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244810
HGNC: HGNC:6658
Sec14l3
Name: SEC14-like lipid binding 3
Synonyms: 1110069O07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380683
Homologene: 24848
Tubb2a
Name: tubulin, beta 2A class IIA
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 22151
VEGA: 13
Homologene: 134314
Grik2
Name: glutamate receptor, ionotropic, kainate 2 (beta 2)
Synonyms: Glurbeta2, Glur-6, C130030K03Rik, Glur6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14806
HGNC: HGNC:4580
Homologene: 40717
Gcnt4
Name: glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)
Synonyms: C2GNT3, LOC218476, LOC238786, Gm73
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218476
VEGA: 13
Homologene: 41144
Atg10
Name: autophagy related 10
Synonyms: 5430428K15Rik, Apg10p, APG10, 5330424L23Rik, Apg10l
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66795
VEGA: 13
Homologene: 12036
Cmbl
Name: carboxymethylenebutenolidase homolog
Synonyms: 2310016A09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69574
Homologene: 100714
Sdr16c5
Name: short chain dehydrogenase/reductase family 16C, member 5
Synonyms: Rdhe2, Scdr9
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242285
Homologene: 15039
Vmn2r109
Name: vomeronasal 2, receptor 109
Synonyms: EG627814
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627814
Homologene: 129678
Slc47a1
Name: solute carrier family 47, member 1
Synonyms: MATE1, 1300013J15Rik, mMATE1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67473
Homologene: 34364
Itga3
Name: integrin alpha 3
Synonyms: VLA-3 alpha 3, alpha3-integrin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16400
HGNC: HGNC:6139
Homologene: 21129
Gpam
Name: glycerol-3-phosphate acyltransferase, mitochondrial
Synonyms: GPAT1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14732
Homologene: 7343
Klhl40
Name: kelch-like 40
Synonyms: 2310024D23Rik, Kbtbd5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72330
VEGA: 9
Homologene: 17571
Lrr1
Name: leucine rich repeat protein 1
Synonyms: LRR-1, Ppil5, 2410005L11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 69706
VEGA: 12
Homologene: 32677
Prl3d3
Name: prolactin family 3, subfamily d, member 3
Synonyms: PL-Ig, Plig
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 215029
Homologene: 137215
Gpr156
Name: G protein-coupled receptor 156
Synonyms: Gababl
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239845
VEGA: 16
Homologene: 17683
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546165
VEGA: 9
Slc17a4
Name: solute carrier family 17 (sodium phosphate), member 4
Synonyms: 9130214H05Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319848
Homologene: 21127
9330154J02Rik
Name: RIKEN cDNA 9330154J02 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 442799
1700028I16Rik
Name: RIKEN cDNA 1700028I16 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70003
Mid1ip1
Name: Mid1 interacting protein 1 (gastrulation specific G12-like (zebrafish))
Synonyms: Mig12, 3110038L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 68041
Homologene: 10936
Glra2
Name: glycine receptor, alpha 2 subunit
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 237213
HGNC: HGNC:4327
Homologene: 31070
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 75,241,480 bp
  • G to A, chromosome 1 at 90,214,128 bp
  • C to T, chromosome 1 at 139,478,054 bp
  • C to T, chromosome 2 at 32,989,546 bp
  • C to A, chromosome 4 at 4,006,601 bp
  • A to C, chromosome 4 at 115,525,347 bp
  • C to G, chromosome 4 at 121,054,258 bp
  • T to C, chromosome 5 at 43,718,714 bp
  • A to T, chromosome 6 at 34,745,765 bp
  • A to G, chromosome 7 at 3,706,824 bp
  • A to G, chromosome 7 at 24,260,556 bp
  • T to A, chromosome 7 at 132,883,138 bp
  • T to C, chromosome 9 at 39,597,908 bp
  • A to C, chromosome 9 at 63,144,448 bp
  • T to C, chromosome 9 at 85,843,114 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • A to G, chromosome 9 at 121,780,416 bp
  • C to A, chromosome 10 at 14,128,969 bp
  • T to A, chromosome 10 at 49,240,808 bp
  • C to T, chromosome 10 at 70,542,648 bp
  • A to G, chromosome 10 at 82,812,385 bp
  • T to A, chromosome 10 at 111,495,322 bp
  • A to G, chromosome 11 at 4,071,544 bp
  • T to C, chromosome 11 at 6,267,712 bp
  • A to T, chromosome 11 at 35,508,237 bp
  • G to T, chromosome 11 at 61,353,058 bp
  • A to G, chromosome 11 at 95,057,269 bp
  • T to C, chromosome 12 at 69,178,567 bp
  • A to T, chromosome 13 at 17,893,174 bp
  • C to T, chromosome 13 at 23,901,769 bp
  • T to C, chromosome 13 at 27,157,406 bp
  • G to T, chromosome 13 at 34,075,311 bp
  • A to T, chromosome 13 at 90,937,380 bp
  • A to G, chromosome 13 at 96,659,089 bp
  • A to T, chromosome 13 at 96,947,014 bp
  • T to A, chromosome 14 at 30,935,828 bp
  • G to T, chromosome 15 at 16,823,438 bp
  • T to A, chromosome 15 at 31,009,028 bp
  • T to C, chromosome 15 at 31,581,998 bp
  • T to A, chromosome 15 at 77,964,100 bp
  • T to C, chromosome 16 at 22,009,735 bp
  • T to A, chromosome 16 at 37,988,600 bp
  • A to G, chromosome 17 at 20,554,442 bp
  • A to G, chromosome 17 at 67,782,176 bp
  • A to G, chromosome 18 at 10,024,532 bp
  • T to A, chromosome 19 at 30,118,675 bp
  • T to C, chromosome 19 at 55,080,458 bp
  • T to C, chromosome X at 10,718,381 bp
  • C to A, chromosome X at 96,160,199 bp
  • C to T, chromosome X at 165,289,616 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3839 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040892-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.