Strain Name:
C57BL/6J-MtgxR4152Btlr/Mmmh
Stock Number:
040996-MU
Citation ID:
RRID:MMRRC_040996-MU
Other Names:
R4152 (G1), C57BL/6J-MtgxR4152Btlr
Major Collection:

Strain Information

Sim1
Name: single-minded family bHLH transcription factor 1
Synonyms: bHLHe14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20464
VEGA: 10
Homologene: 3715
Upf1
Name: UPF1 RNA helicase and ATPase
Synonyms: Rent1, B430202H16Rik, PNORF-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19704
HGNC: HGNC:9962
Homologene: 2185
Slit3
Name: slit guidance ligand 3
Synonyms: b2b2362.1Clo, Slit1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20564
Homologene: 2303
Tlr6
Name: toll-like receptor 6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21899
Homologene: 21223
Map3k8
Name: mitogen-activated protein kinase kinase kinase 8
Synonyms: Tpl2, Cot, Cot/Tpl2, Tpl-2, c-COT
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 26410
HGNC: HGNC:6860
Homologene: 3812
Phf3
Name: PHD finger protein 3
Synonyms: AU020177, 2310061N19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213109
HGNC: HGNC:8921
Homologene: 9040
Gcn1
Name: GCN1 activator of EIF2AK4
Synonyms: G431004K08Rik, GCN1L, Gcn1l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231659
HGNC: HGNC:4199
Homologene: 5887
Pds5a
Name: PDS5 cohesin associated factor A
Synonyms: 9030416H16Rik, E230024D05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71521
Homologene: 22877
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Acaca
Name: acetyl-Coenzyme A carboxylase alpha
Synonyms: A530025K05Rik, Acac, Acc1, LOC327983, acetyl-CoA carboxylase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107476
HGNC: HGNC:84
Homologene: 31015
Pabpc1
Name: poly(A) binding protein, cytoplasmic 1
Synonyms: Pabpl1, Pabp1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18458
Homologene: 37638
Gnb4
Name: guanine nucleotide binding protein (G protein), beta 4
Synonyms: 6720453A21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14696
Homologene: 69140
Rab4b
Name: RAB4B, member RAS oncogene family
Synonyms: 1500031G17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19342
HGNC: HGNC:9782
Homologene: 100632
St14
Name: suppression of tumorigenicity 14 (colon carcinoma)
Synonyms: Epithin, MT-SP1, matriptase, Tmprss14, Prss14
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19143
Homologene: 7906
Mavs
Name: mitochondrial antiviral signaling protein
Synonyms: IPS-1, D430028G21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228607
Homologene: 17004
Pgk2
Name: phosphoglycerate kinase 2
Synonyms: Pgk-2, Tcp-2, Tcp-2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18663
VEGA: 17
HGNC: HGNC:8898
Homologene: 57138
Akap6
Name: A kinase anchor protein 6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238161
VEGA: 12
HGNC: HGNC:376
Homologene: 3157
Ndst3
Name: N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms: 4930511P15Rik, 4921531K01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 83398
HGNC: HGNC:7682
Homologene: 3513
Or7g20
Name: olfactory receptor family 7 subfamily G member 20
Synonyms: MOR150-3, GA_x6K02T2PVTD-12771995-12772930, Olfr835
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 257872
HGNC: HGNC:8466
Homologene: 133702
Or8g52
Name: olfactory receptor family 8 subfamily G member 52
Synonyms: GA_x6K02T2PVTD-33416730-33417668, Olfr965, MOR171-28
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258165
VEGA: 9
Vmn2r100
Name: vomeronasal 2, receptor 100
Synonyms: EG627537
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627537
Homologene: 129750
Sntg1
Name: syntrophin, gamma 1
Synonyms: G1SYN, SYN4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71096
Homologene: 56834
Fcgbpl1
Name: Fc fragment of IgG binding protein like 1
Synonyms: 9530053A07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319482
Homologene: 130055
Cdc16
Name: CDC16 cell division cycle 16
Synonyms: 2700071J12Rik, 2810431D22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69957
HGNC: HGNC:1720
Homologene: 2899
Ap3b2
Name: adaptor-related protein complex 3, beta 2 subunit
Synonyms: Naptb, beta3B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11775
HGNC: HGNC:567
Homologene: 55837
Slc5a3
Name: solute carrier family 5 (inositol transporters), member 3
Synonyms: Smit1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 53881
Homologene: 31412
Tspan15
Name: tetraspanin 15
Synonyms: Tm4sf15, 2700063A19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70423
VEGA: 10
Homologene: 22716
Col4a1
Name: collagen, type IV, alpha 1
Synonyms: Del(8)44H, Raw, Svc, Bru, alpha1(IV) collagen, Del(8)Bru44H, Col4a-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12826
HGNC: HGNC:2202
Homologene: 20437
Vmn2r18
Name: vomeronasal 2, receptor 18
Synonyms: EG632671
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 632671
Vmn2r66
Name: vomeronasal 2, receptor 66
Synonyms: F830104D24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233437
Homologene: 115466
Zc3h15
Name: zinc finger CCCH-type containing 15
Synonyms: FM22, 2610312B22Rik, 1700006A17Rik, Ierepo4, 1810012H02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69082
Homologene: 10216
Nemp2
Name: nuclear envelope integral membrane protein 2
Synonyms: 5330401P04Rik, Tmem194b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227094
Homologene: 67089
Clcn4
Name: chloride channel, voltage-sensitive 4
Synonyms: Clcn4-2, Clc4-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12727
HGNC: HGNC:2022
Homologene: 68207
Or52b1
Name: olfactory receptor family 52 subfamily B member 1
Synonyms: Olfr690, MOR31-2, GA_x6K02T2PBJ9-7959171-7958224
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56860
Homologene: 10653
Rsad1
Name: radical S-adenosyl methionine domain containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237926
Homologene: 41252
Klk14
Name: kallikrein related-peptidase 14
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 317653
HGNC: HGNC:6362
Homologene: 69348
Lpgat1
Name: lysophosphatidylglycerol acyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226856
Homologene: 8914
Tmem132a
Name: transmembrane protein 132A
Synonyms: 6720481D13Rik, Hspa5bp1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 98170
Homologene: 75076
Prl8a2
Name: prolactin family 8, subfamily a, member 2
Synonyms: DPRP, mdPRP, D/tPRP, Dtprp
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13529
Homologene: 49230
Gm6483
Name: predicted gene 6483
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 624198
Snx31
Name: sorting nexin 31
Synonyms: 4631426E05Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66696
Homologene: 23551
Klk1b16
Name: kallikrein 1-related peptidase b16
Synonyms: Klk16, mGk-16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16615
Homologene: 68141
Fam78b
Name: family with sequence similarity 78, member B
Synonyms: C030020L09Rik, C030014K22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226610
Homologene: 18451
Vegfb
Name: vascular endothelial growth factor B
Synonyms: VEGF-B, Vrf
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 22340
Homologene: 87131
Gm26794
Name: predicted gene, 26794
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 8,583,345 bp
  • C to T, chromosome 1 at 30,831,458 bp
  • A to G, chromosome 1 at 52,641,051 bp
  • T to C, chromosome 1 at 167,078,800 bp
  • C to A, chromosome 1 at 191,719,488 bp
  • A to G, chromosome 2 at 55,437,290 bp
  • T to C, chromosome 2 at 83,658,569 bp
  • A to G, chromosome 2 at 131,246,608 bp
  • A to G, chromosome 3 at 32,589,811 bp
  • T to C, chromosome 3 at 123,672,227 bp
  • A to C, chromosome 5 at 64,953,212 bp
  • A to T, chromosome 5 at 65,666,171 bp
  • A to G, chromosome 5 at 115,613,354 bp
  • T to A, chromosome 5 at 151,562,265 bp
  • T to C, chromosome 7 at 7,294,834 bp
  • T to C, chromosome 7 at 27,176,126 bp
  • T to A, chromosome 7 at 28,156,897 bp
  • G to A, chromosome 7 at 43,692,077 bp
  • T to C, chromosome 7 at 44,140,549 bp
  • A to G, chromosome 7 at 81,478,017 bp
  • T to C, chromosome 7 at 85,005,592 bp
  • T to C, chromosome 7 at 105,329,385 bp
  • T to C, chromosome 8 at 11,217,227 bp
  • A to G, chromosome 8 at 13,762,857 bp
  • T to C, chromosome 8 at 19,687,910 bp
  • C to T, chromosome 8 at 70,338,460 bp
  • T to A, chromosome 9 at 19,035,520 bp
  • T to C, chromosome 9 at 31,090,506 bp
  • A to C, chromosome 9 at 39,720,000 bp
  • G to A, chromosome 10 at 50,983,854 bp
  • A to T, chromosome 10 at 62,189,842 bp
  • A to G, chromosome 11 at 35,698,320 bp
  • T to G, chromosome 11 at 84,292,926 bp
  • T to C, chromosome 11 at 94,548,623 bp
  • A to C, chromosome 12 at 53,140,407 bp
  • T to C, chromosome 13 at 27,351,002 bp
  • G to A, chromosome 14 at 50,837,594 bp
  • T to C, chromosome 15 at 36,525,639 bp
  • G to A, chromosome 15 at 36,605,810 bp
  • T to A, chromosome 16 at 92,077,808 bp
  • AAAACAGGAGTATTGATTGGAAAC to AAAAC, chromosome 17 at 19,523,419 bp
  • A to G, chromosome 17 at 40,208,258 bp
  • G to T, chromosome 18 at 3,288,055 bp
  • G to A, chromosome 18 at 4,332,312 bp
  • T to C, chromosome 19 at 6,986,078 bp
  • A to G, chromosome 19 at 10,859,063 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4152 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040996-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.