Strain Name:
C57BL/6J-MtgxR4213Btlr/Mmmh
Stock Number:
041040-MU
Citation ID:
RRID:MMRRC_041040-MU
Other Names:
R4213 (G1), C57BL/6J-MtgxR4213Btlr
Major Collection:

Strain Information

Cd4
Name: CD4 antigen
Synonyms: L3T4, Ly-4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12504
HGNC: HGNC:1678
Homologene: 513
Gk5
Name: glycerol kinase 5
Synonyms: G630067D24Rik, C330018K18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235533
Homologene: 15141
Ppp2r5e
Name: protein phosphatase 2, regulatory subunit B', epsilon
Synonyms: 4633401M22Rik, protein phosphatase 2A subunit beta, B56beta
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 26932
VEGA: 12
HGNC: HGNC:9313
Homologene: 55962
Ankrd11
Name: ankyrin repeat domain 11
Synonyms: Yod, 3010027A04Rik, 9530048I21Rik, 2410104C19Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 77087
Homologene: 69134
Cad
Name: carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms: 2410008J01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69719
HGNC: HGNC:1424
Homologene: 1412
Depdc1b
Name: DEP domain containing 1B
Synonyms: XTP1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218581
Homologene: 10157
Cep350
Name: centrosomal protein 350
Synonyms: 6430546F08Rik, 4933409L06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74081
Homologene: 8879
Ecpas
Name: Ecm29 proteasome adaptor and scaffold
Synonyms: AI314180
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230249
Homologene: 6056
Tlr4
Name: toll-like receptor 4
Synonyms: Lps, lipopolysaccharide response, Rasl2-8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21898
Homologene: 41317
Robo3
Name: roundabout guidance receptor 3
Synonyms: Robo3b, Rig1, Rig-1, Rbig1, Robo3a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19649
Homologene: 32119
Hdc
Name: histidine decarboxylase
Synonyms: Hdc-a, Hdc-c, Hdc-e, L-histidine decarboxylase, Hdc-s
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15186
HGNC: HGNC:4855
Homologene: 20490
Tob1
Name: transducer of ErbB-2.1
Synonyms: Trob, Tob
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22057
Homologene: 31334
Zswim1
Name: zinc finger SWIM-type containing 1
Synonyms: 2410003H12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71971
Homologene: 12429
Arhgap28
Name: Rho GTPase activating protein 28
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268970
Homologene: 18264
Col4a4
Name: collagen, type IV, alpha 4
Synonyms: E130010M05Rik, [a]4(IV)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12829
HGNC: HGNC:2206
Homologene: 20071
Itgae
Name: integrin alpha E, epithelial-associated
Synonyms: CD103, alpha-E1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16407
HGNC: HGNC:6147
Homologene: 113560
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: 4930545D19Rik, 1700034M11Rik, hy3, hyrh, hy-3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: Adgrc1, crash, Crsh, Scy
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Sorcs1
Name: sortilin-related VPS10 domain containing receptor 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 58178
Homologene: 10967
Siglec1
Name: sialic acid binding Ig-like lectin 1, sialoadhesin
Synonyms: CD169, Siglec-1, Sn
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20612
Homologene: 124458
Nlrp9c
Name: NLR family, pyrin domain containing 9C
Synonyms: Nalp-zeta, Nalp9c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330490
Homologene: 116072
Sqor
Name: sulfide quinone oxidoreductase
Synonyms: 0610039J17Rik, flavo-binding protein, 4930557M22Rik, Sqrdl
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 59010
Homologene: 10921
Cadps2
Name: Ca2+-dependent activator protein for secretion 2
Synonyms: Caps2, cpd2, A230044C21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320405
Homologene: 23060
Or5d16
Name: olfactory receptor family 5 subfamily D member 16
Synonyms: MOR174-10, GA_x6K02T2Q125-49426894-49425950, Olfr1155
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258636
Homologene: 133739
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: C130090D05Rik, Kv12.1, ELK1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Chml
Name: choroideremia-like
Synonyms: E030003F13Rik, Rep2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12663
HGNC: HGNC:1941
Homologene: 31055
Pira13
Name: paired-Ig-like receptor A13
Synonyms: Gm15448, ENSMUSG00000074419
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100041146
Homologene: 134028
Nmur1
Name: neuromedin U receptor 1
Synonyms: Gpr66, NMU1R, NmU-R, FM-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14767
HGNC: HGNC:4518
Homologene: 68501
Kplce
Name: KPRP N-terminal and LCE C-terminal like protein
Synonyms: 2310050C09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66533
Homologene: 104374
Slc2a12
Name: solute carrier family 2 (facilitated glucose transporter), member 12
Synonyms: GLUT-12, Glut12
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 353169
Homologene: 59263
Ct45a
Name: cancer/testis antigen 45
Synonyms: LOC270599, Gm648
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 270599
Dipk1b
Name: divergent protein kinase domain 1B
Synonyms: PIP49, B230317C12Rik, Fam69b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56279
Homologene: 10516
Fbxo25
Name: F-box protein 25
Synonyms: Fbx25, 9130015I06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66822
Homologene: 41649
Gpr137c
Name: G protein-coupled receptor 137C
Synonyms: LOC380893, 6330416L11Rik, TM7SF1L2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70713
Homologene: 28613
Yjefn3
Name: YjeF N-terminal domain containing 3
Synonyms: LOC234365
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234365
Krtap17-1
Name: keratin associated protein 17-1
Synonyms: A030006P16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 77914
Gm16090
Name: predicted gene 16090
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 102633478
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 82,453,144 bp
  • T to G, chromosome 1 at 86,387,784 bp
  • C to G, chromosome 1 at 155,935,961 bp
  • A to T, chromosome 1 at 175,686,695 bp
  • C to T, chromosome 2 at 26,635,948 bp
  • T to C, chromosome 2 at 87,943,121 bp
  • G to T, chromosome 2 at 122,787,498 bp
  • C to T, chromosome 2 at 126,597,866 bp
  • C to T, chromosome 2 at 131,074,118 bp
  • T to C, chromosome 2 at 164,825,785 bp
  • G to A, chromosome 3 at 92,869,127 bp
  • T to C, chromosome 4 at 58,834,076 bp
  • T to A, chromosome 4 at 66,840,326 bp
  • G to A, chromosome 5 at 31,072,344 bp
  • A to T, chromosome 6 at 23,599,463 bp
  • A to G, chromosome 6 at 124,870,459 bp
  • C to A, chromosome 7 at 3,821,554 bp
  • T to A, chromosome 7 at 26,380,536 bp
  • A to G, chromosome 8 at 13,939,581 bp
  • G to T, chromosome 8 at 69,890,890 bp
  • A to G, chromosome 8 at 110,456,507 bp
  • A to C, chromosome 8 at 122,891,026 bp
  • C to T, chromosome 9 at 37,421,898 bp
  • T to C, chromosome 9 at 96,129,053 bp
  • A to T, chromosome 10 at 22,702,094 bp
  • A to G, chromosome 11 at 73,119,352 bp
  • A to G, chromosome 11 at 94,214,192 bp
  • A to G, chromosome 11 at 99,993,914 bp
  • A to G, chromosome 12 at 75,469,551 bp
  • T to G, chromosome 13 at 108,388,691 bp
  • G to A, chromosome 14 at 45,246,508 bp
  • G to A, chromosome 15 at 86,031,807 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • A to T, chromosome 17 at 67,871,993 bp
  • T to C, chromosome 18 at 20,598,514 bp
  • G to A, chromosome 19 at 50,225,175 bp
  • C to T, chromosome X at 56,545,208 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4213 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041040-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.