Strain Name:
C57BL/6J-MtgxR4305Btlr/Mmmh
Stock Number:
041091-MU
Citation ID:
RRID:MMRRC_041091-MU
Other Names:
R4305 (G1), C57BL/6J-MtgxR4305Btlr
Major Collection:

Strain Information

Abl2
Name: ABL proto-oncogene 2, non-receptor tyrosine kinase
Synonyms: Abll, Arg
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11352
HGNC: HGNC:77
Homologene: 5278
Gart
Name: phosphoribosylglycinamide formyltransferase
Synonyms: Prgs, Gaps
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14450
HGNC: HGNC:4163
Homologene: 637
Yeats2
Name: YEATS domain containing 2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208146
VEGA: 16
Homologene: 9967
Lpar6
Name: lysophosphatidic acid receptor 6
Synonyms: P2ry5, 2610302I02Rik, P2y5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67168
Homologene: 55925
Mtch2
Name: mitochondrial carrier 2
Synonyms: 2310034D24Rik, HSPC032, 4930539J07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56428
Homologene: 8645
Thap1
Name: THAP domain containing, apoptosis associated protein 1
Synonyms: 4833431A01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73754
Homologene: 10005
Nlrp3
Name: NLR family, pyrin domain containing 3
Synonyms: Pypaf1, NALP3, Mmig1, Cias1, cryopyrin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216799
Homologene: 3600
Chrdl2
Name: chordin-like 2
Synonyms: Chl2, 1810022C01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69121
Homologene: 128795
Epha6
Name: Eph receptor A6
Synonyms: m-ehk2, Hek12, Ehk2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13840
Homologene: 56396
Notch1
Name: notch 1
Synonyms: 9930111A19Rik, lin-12, N1, Motch A, Mis6, Tan1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18128
HGNC: HGNC:7881
Homologene: 32049
Med23
Name: mediator complex subunit 23
Synonyms: X83317, ESTM7, sno, Crsp3, Sur2, 3000002A17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70208
HGNC: HGNC:2372
Homologene: 3552
Jag1
Name: jagged 1
Synonyms: Serrate-1, Headturner, Ozz, Htu, Gsfabe2, ABE2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16449
HGNC: HGNC:6188
Homologene: 180
H2-K1
Name: histocompatibility 2, K1, K region
Synonyms: H-2K
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14972
Homologene: 128352
Ttn
Name: titin
Synonyms: shru, L56, mdm, connectin, D330041I19Rik, 2310057K23Rik, 2310074I15Rik, 2310036G12Rik, D830007G01Rik, 1100001C23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Ccr5
Name: C-C motif chemokine receptor 5
Synonyms: CD195, Cmkbr5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12774
HGNC: HGNC:1606
Homologene: 37325
Or4k37
Name: olfactory receptor family 4 subfamily K member 37
Synonyms: GA_x6K02T2Q125-72379864-72380781, Olfr1281, MOR248-18, MOR248-14P
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257979
Homologene: 73992
Ceacam23
Name: CEA cell adhesion moleculen23
Synonyms: Gm5155
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 381852
HGNC: HGNC:1819
Homologene: 115938
Ugt3a2
Name: UDP glycosyltransferases 3 family, polypeptide A2
Synonyms: Ugt3a, Ugt3a1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105887
Homologene: 122787
Asap2
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Synonyms: LOC385250, Ddef2, 6530401G17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211914
HGNC: HGNC:2721
Homologene: 2888
Atxn7l1
Name: ataxin 7-like 1
Synonyms: Atxn7l4, 2810423G08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380753
Homologene: 53366
A830018L16Rik
Name: RIKEN cDNA A830018L16 gene
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320492
Homologene: 14194
Rbm20
Name: RNA binding motif protein 20
Synonyms: 2010003H22Rik, 1110018J23Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73713
Homologene: 28386
Garin1b
Name: golgi associated RAB2 interactor 1B
Synonyms: Fam71f1, LOC330277
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330277
Homologene: 13077
Krt1
Name: keratin 1
Synonyms: Krt-2.1, Krt2-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Vmn2r71
Name: vomeronasal 2, receptor 71
Synonyms: EG233445
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233445
Homologene: 115466
Vps9d1
Name: VPS9 domain containing 1
Synonyms: 1300018I17Rik, 2410004N05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72325
Homologene: 21021
Gm7173
Name: predicted gene 7173
Synonyms:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Cd27
Name: CD27 antigen
Synonyms: Tnfrsf7, Cd27, S152, Tp55
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21940
Homologene: 74386
Zdhhc4
Name: zinc finger, DHHC domain containing 4
Synonyms: 2900029I10Rik, 1810021D01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72881
Homologene: 10006
Ccl27a
Name: C-C motif chemokine ligand 27A
Synonyms: Ccl27, skinskine, ALP, CTACK, ILC, CTAK, ESkine, Scya27a, Scya27, PESKY, mILC, ESkine
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20301
Homologene: 134761
Tex11
Name: testis expressed gene 11
Synonyms: 4930565P14Rik
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 83558
Homologene: 49962
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 11,972,076 bp
  • T to A, chromosome 1 at 156,641,563 bp
  • T to C, chromosome 2 at 26,477,924 bp
  • T to C, chromosome 2 at 76,918,337 bp
  • A to G, chromosome 2 at 90,859,483 bp
  • A to G, chromosome 2 at 111,329,298 bp
  • C to A, chromosome 2 at 137,085,081 bp
  • A to G, chromosome 4 at 41,769,487 bp
  • C to T, chromosome 5 at 143,324,344 bp
  • A to G, chromosome 6 at 29,326,612 bp
  • A to G, chromosome 6 at 125,234,670 bp
  • T to A, chromosome 7 at 17,905,193 bp
  • G to T, chromosome 7 at 85,624,152 bp
  • A to G, chromosome 7 at 100,022,022 bp
  • AGCAGCATCTGCTCG to AG, chromosome 8 at 26,160,854 bp
  • G to T, chromosome 8 at 123,248,237 bp
  • T to C, chromosome 9 at 124,125,074 bp
  • G to T, chromosome 10 at 24,904,270 bp
  • C to T, chromosome 11 at 59,548,010 bp
  • T to C, chromosome 12 at 21,229,481 bp
  • T to C, chromosome 12 at 33,341,992 bp
  • G to A, chromosome 14 at 73,238,941 bp
  • A to C, chromosome 15 at 9,306,274 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • A to G, chromosome 16 at 20,208,422 bp
  • T to C, chromosome 16 at 60,526,520 bp
  • T to C, chromosome 16 at 91,633,992 bp
  • C to T, chromosome 17 at 33,999,816 bp
  • A to G, chromosome 19 at 53,843,260 bp
  • C to G, chromosome X at 79,498,029 bp
  • C to A, chromosome X at 100,933,415 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4305 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041091-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.