Strain Name:
C57BL/6J-MtgxR4364Btlr/Mmmh
Stock Number:
041672-MU
Citation ID:
RRID:MMRRC_041672-MU
Other Names:
R4364 (G1), C57BL/6J-MtgxR4364Btlr
Major Collection:

Strain Information

Atrn
Name: attractin
Synonyms: Mgca
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11990
HGNC: HGNC:885
Homologene: 22542
Apoa5
Name: apolipoprotein A-V
Synonyms: RAP3, 1300007O05Rik, Apoav
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66113
Homologene: 14197
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 2610510B01Rik, 0610038M01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Exoc6b
Name: exocyst complex component 6B
Synonyms: G430127E12Rik, 4930569O18Rik, Sec15b, Sec15l2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75914
Homologene: 44781
Eif4e2
Name: eukaryotic translation initiation factor 4E member 2
Synonyms: D0H0S6743E, Eif4el3, 2700069E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 26987
HGNC: HGNC:3293
Homologene: 128466
Dhx35
Name: DEAH-box helicase 35
Synonyms: 1200009D07Rik, Ddx35
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71715
Homologene: 6406
Shroom3
Name: shroom family member 3
Synonyms: Shrm3, D5Ertd287e, Shrm
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27428
Homologene: 9263
Cct2
Name: chaperonin containing TCP1 subunit 2
Synonyms: Cctb
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12461
VEGA: 10
HGNC: HGNC:1615
Homologene: 4696
Nup205
Name: nucleoporin 205
Synonyms: 3830404O05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70699
Homologene: 45971
Usp10
Name: ubiquitin specific peptidase 10
Synonyms: 2610014N07Rik, Uchrp
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22224
Homologene: 31294
Frem1
Name: Fras1 related extracellular matrix protein 1
Synonyms: heb, eyem02Jus, eyes2, QBRICK, crf11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329872
Homologene: 27049
Il7r
Name: interleukin 7 receptor
Synonyms: CD127, IL-7Ralpha, IL-7 receptor alpha chain
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16197
VEGA: 15
HGNC: HGNC:6024
Homologene: 1646
Ripor2
Name: RHO family interacting cell polarization regulator 2
Synonyms: Fam65b, 6330500D04Rik, 1700108N18Rik, E430013J17Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 193385
Homologene: 9284
Galnt14
Name: polypeptide N-acetylgalactosaminyltransferase 14
Synonyms: 0610033M06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71685
Homologene: 56997
Fat1
Name: FAT atypical cadherin 1
Synonyms: mFat1, 2310038E12Rik, Fath
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Dpp9
Name: dipeptidylpeptidase 9
Synonyms: DPRP2, 6430584G11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224897
VEGA: 17
Homologene: 16385
Mideas
Name: mitotic deacetylase associated SANT domain protein
Synonyms: 9430029N19Rik, C130039O16Rik, Elmsan1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238317
Homologene: 19330
Sptbn5
Name: spectrin beta, non-erythrocytic 5
Synonyms: EG640524, Spnb5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 640524
Homologene: 41150
Lcn10
Name: lipocalin 10
Synonyms: 9230112J07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 332578
Homologene: 52253
Rhbdl2
Name: rhomboid like 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230726
Homologene: 49508
Prkce
Name: protein kinase C, epsilon
Synonyms: Pkce, PCK epsilon, 5830406C15Rik, PKC[e], PKCepsilon
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18754
HGNC: HGNC:9401
Homologene: 48343
Shoc1
Name: shortage in chiasmata 1
Synonyms: LOC242489, Gm426, AI481877, Mzip2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100155
Homologene: 79783
Il1rl2
Name: interleukin 1 receptor-like 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107527
HGNC: HGNC:5999
Homologene: 2860
Tex10
Name: testis expressed gene 10
Synonyms: 2810462N03Rik, clone 18330, 2610206N19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269536
Homologene: 32361
Glipr1
Name: GLI pathogenesis related 1
Synonyms: RTVP-1, 2410114O14Rik, mRTVP-1, RTVP1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73690
Homologene: 21357
Hspa4l
Name: heat shock protein 4 like
Synonyms: APG-1, Osp94, 94kDa
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18415
Homologene: 22610
Amn
Name: amnionless
Synonyms: 5033428N14Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 93835
VEGA: 12
Homologene: 12804
Krt83
Name: keratin 83
Synonyms: 5430421N21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 100126226
Homologene: 68248
Ehf
Name: ets homologous factor
Synonyms: 9030625L19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13661
HGNC: HGNC:3246
Homologene: 7301
Grid1
Name: glutamate receptor, ionotropic, delta 1
Synonyms: GluRdelta1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14803
HGNC: HGNC:4575
Homologene: 69017
Ttll1
Name: tubulin tyrosine ligase-like 1
Synonyms: 6330444E16Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 319953
HGNC: HGNC:1312
Homologene: 8174
Taar8c
Name: trace amine-associated receptor 8C
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 494546
Homologene: 77586
Ccer1
Name: coiled-coil glutamate-rich protein 1
Synonyms: 4921510H08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66716
VEGA: 10
Homologene: 49839
Or4d10
Name: olfactory receptor family 4 subfamily D member 10
Synonyms: MOR239-7, GA_x6K02T2RE5P-2433425-2432490, Olfr1425
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258155
Homologene: 17398
Or8b12c
Name: olfactory receptor family 8 subfamily B member 12C
Synonyms: GA_x6K02T2PVTD-31489645-31490577, Olfr876, MOR161-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258883
Homologene: 74154
Or4f17-ps1
Name: olfactory receptor family 4 subfamily F member 17, pseudogene 1
Synonyms: GA_x6K02T2Q125-72578807-72579745, MOR245-24P, OTTMUSG00000015076, Olfr1293-ps
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 623583
Gm23573
Name: predicted gene, 23573
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 115487488
VEGA: 10
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 40,351,791 bp
  • T to C, chromosome 1 at 87,224,371 bp
  • G to T, chromosome 2 at 25,684,040 bp
  • G to T, chromosome 2 at 103,273,901 bp
  • G to A, chromosome 2 at 111,527,640 bp
  • A to G, chromosome 2 at 120,068,655 bp
  • A to G, chromosome 2 at 130,970,208 bp
  • C to T, chromosome 2 at 158,842,352 bp
  • C to A, chromosome 3 at 40,766,809 bp
  • T to C, chromosome 4 at 48,468,774 bp
  • T to G, chromosome 4 at 59,082,294 bp
  • A to T, chromosome 4 at 82,913,251 bp
  • T to A, chromosome 4 at 123,809,935 bp
  • G to T, chromosome 5 at 92,943,086 bp
  • C to A, chromosome 6 at 35,192,027 bp
  • A to T, chromosome 6 at 85,003,179 bp
  • T to A, chromosome 8 at 44,952,962 bp
  • A to G, chromosome 8 at 119,951,946 bp
  • A to T, chromosome 9 at 37,804,190 bp
  • A to T, chromosome 9 at 46,270,529 bp
  • A to G, chromosome 10 at 5,353,987 bp
  • C to T, chromosome 10 at 24,101,579 bp
  • CGAGGAGGAGGAGGAGGAGGA to CGAGGAGGAGGAGGAGGA, chromosome 10 at 97,694,370 bp
  • T to C, chromosome 10 at 111,985,637 bp
  • A to G, chromosome 10 at 117,055,151 bp
  • C to T, chromosome 12 at 84,156,471 bp
  • A to C, chromosome 12 at 111,271,762 bp
  • C to T, chromosome 13 at 24,721,711 bp
  • A to G, chromosome 14 at 34,946,032 bp
  • T to A, chromosome 15 at 9,512,928 bp
  • T to A, chromosome 15 at 83,499,994 bp
  • T to G, chromosome 15 at 101,487,514 bp
  • A to G, chromosome 16 at 93,770,924 bp
  • T to C, chromosome 17 at 56,187,391 bp
  • A to G, chromosome 17 at 73,512,159 bp
  • C to T, chromosome 17 at 86,476,851 bp
  • A to G, chromosome 19 at 12,074,497 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4364 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041672-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.