Strain Name:
C57BL/6J-MtgxR4537Btlr/Mmmh
Stock Number:
041774-MU
Citation ID:
RRID:MMRRC_041774-MU
Other Names:
R4537 (G1), C57BL/6J-MtgxR4537Btlr
Major Collection:

Strain Information

Olig2
Name: oligodendrocyte transcription factor 2
Synonyms: RK17, Bhlhb1, bHLHe19, Olg-2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 50913
HGNC: HGNC:9398
Homologene: 4241
Srd5a3
Name: steroid 5 alpha-reductase 3
Synonyms: Srd5a2l, 1110025P14Rik, D730040M03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57357
Homologene: 41385
Arid4b
Name: AT-rich interaction domain 4B
Synonyms: Rbp1l1, 6330417L24Rik, RBBP1L1, 6720480E17Rik, SAP180, BRCAA1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 94246
Homologene: 12847
Oxr1
Name: oxidation resistance 1
Synonyms: C7, C7B, 2210416C20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170719
VEGA: 15
Homologene: 24993
Slc25a12
Name: solute carrier family 25 (mitochondrial carrier, Aralar), member 12
Synonyms: B230107K20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78830
Homologene: 48235
Slc2a3
Name: solute carrier family 2 (facilitated glucose transporter), member 3
Synonyms: Glut-3, Glut3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20527
Homologene: 74302
Zfp101
Name: zinc finger protein 101
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22643
Homologene: 137226
Armc9
Name: armadillo repeat containing 9
Synonyms: 4831423D23Rik, 5730415N24Rik, 3830422A13Rik, 4930438O05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78795
Homologene: 11847
Fus
Name: fused in sarcoma
Synonyms: translocated in liposarcoma, D430004D17Rik, hnRNP P2, Tls, pigpen, D930039C12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233908
HGNC: HGNC:4010
Homologene: 134091
Gphn
Name: gephyrin
Synonyms: geph, 5730552E08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268566
VEGA: 12
Homologene: 10820
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, MCPH5, D330028K02Rik, Aspm, Calmbp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12316
Homologene: 7650
Itgb2
Name: integrin beta 2
Synonyms: Mac-1 beta, Cd18, 2E6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16414
HGNC: HGNC:6155
Homologene: 20092
Tob1
Name: transducer of ErbB-2.1
Synonyms: Trob, Tob
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22057
Homologene: 31334
Rae1
Name: ribonucleic acid export 1
Synonyms: MNRP41, 41, MNRP, D2Ertd342e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66679
HGNC: HGNC:9828
Homologene: 2676
Sost
Name: sclerostin
Synonyms: 5430411E23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74499
Homologene: 11542
Dnajc13
Name: DnaJ heat shock protein family (Hsp40) member C13
Synonyms: LOC382100, D030002L11Rik, Rme8
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235567
Homologene: 13574
Tns2
Name: tensin 2
Synonyms: nep, nph, Tenc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 209039
VEGA: 15
Homologene: 37077
Flt1
Name: FMS-like tyrosine kinase 1
Synonyms: Flt-1, VEGFR1, sFlt1, vascular endothelial growth factor receptor-1, VEGFR-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14254
HGNC: HGNC:3763
Homologene: 134179
Ogfod2
Name: 2-oxoglutarate and iron-dependent oxygenase domain containing 2
Synonyms: 5730405M13Rik, 1300006G11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66627
Homologene: 32588
Uspl1
Name: ubiquitin specific peptidase like 1
Synonyms: E430026A01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231915
Homologene: 4235
Ulk4
Name: unc-51-like kinase 4
Synonyms: 4932415A06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 209012
Homologene: 41205
Grm3
Name: glutamate receptor, metabotropic 3
Synonyms: 0710001G23Rik, mGlu3, mGluR3, Gprc1c
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 108069
HGNC: HGNC:4595
Homologene: 651
Slc5a4a
Name: solute carrier family 5, member 4a
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64452
VEGA: 10
Vmn2r93
Name: vomeronasal 2, receptor 93
Synonyms: EG627132
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627132
Homologene: 129750
Fam83b
Name: family with sequence similarity 83, member B
Synonyms: C530008M07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208994
Homologene: 19478
Dpy19l3
Name: dpy-19 like C-mannosyltransferase 3
Synonyms: 9330164H19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233115
Homologene: 18692
Zfp558
Name: zinc finger protein 558
Synonyms: Zfp558-ps, 1700007A21Rik, 4932704I17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72230
Homologene: 44903
Myo18b
Name: myosin XVIIIb
Synonyms: 4932408L24Rik, 4933411E19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74376
Homologene: 53435
Fnip2
Name: folliculin interacting protein 2
Synonyms: D630023B12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329679
Homologene: 46417
Vmn2r87
Name: vomeronasal 2, receptor 87
Synonyms: EG625131
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625131
Homologene: 129606
Tspoap1
Name: TSPO associated protein 1
Synonyms: peripheral, Bzrap1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207777
Homologene: 37961
Marchf1
Name: membrane associated ring-CH-type finger 1
Synonyms: 2900024D24Rik, March1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72925
Homologene: 113749
Or7g19
Name: olfactory receptor family 7 subfamily G member 19
Synonyms: GA_x6K02T2PVTD-12687800-12688738, MOR153-1, Olfr832
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258075
HGNC: HGNC:8467
Homologene: 128143
Or56a42-ps1
Name: olfactory receptor family 56 subfamily A member 42, pseudogene 1
Synonyms: GA_x6K02T2PBJ9-7755919-7755070, Olfr682-ps1, Olfr217-ps1, MOR40-19_p, MOR40-6P, GA_x6K02SYW8DF-188-1037
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258187
Defb30
Name: defensin beta 30
Synonyms: 2410125J01Rik, 4930449O14Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 73670
Homologene: 86862
Or10g9
Name: olfactory receptor family 10 subfamily G member 9
Synonyms: GA_x6K02T2PVTD-33699706-33698771, Olfr979, MOR223-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 259112
VEGA: 9
Homologene: 81556
Mrpl24
Name: mitochondrial ribosomal protein L24
Synonyms: 6720473G22Rik, 2810470K06Rik, 2010005E08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67707
Homologene: 12241
Sprr2f
Name: small proline-rich protein 2F
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20760
Gm21759
Name: predicted gene, 21759
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 102633023
Hoxa1
Name: homeobox A1
Synonyms: early retinoic acid, ERA1, Hox-1.6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15394
HGNC: HGNC:5099
Homologene: 4032
Gm15763
Name: predicted gene 15763
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Ighv14-2
Name: immunoglobulin heavy variable 14-2
Synonyms: Gm16683
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 668421
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 86,213,093 bp
  • T to C, chromosome 1 at 139,474,303 bp
  • T to A, chromosome 2 at 71,275,106 bp
  • G to T, chromosome 2 at 173,015,392 bp
  • T to A, chromosome 2 at 177,314,559 bp
  • A to G, chromosome 3 at 79,465,714 bp
  • A to C, chromosome 3 at 87,922,412 bp
  • A to T, chromosome 3 at 92,366,059 bp
  • A to T, chromosome 5 at 8,179,817 bp
  • A to G, chromosome 5 at 9,512,083 bp
  • G to A, chromosome 5 at 76,149,951 bp
  • A to G, chromosome 5 at 112,692,948 bp
  • C to T, chromosome 5 at 124,114,528 bp
  • A to G, chromosome 5 at 147,615,202 bp
  • A to G, chromosome 5 at 149,187,778 bp
  • G to T, chromosome 6 at 52,157,993 bp
  • C to A, chromosome 6 at 122,737,104 bp
  • C to T, chromosome 6 at 148,262,782 bp
  • T to C, chromosome 7 at 35,711,901 bp
  • T to A, chromosome 7 at 105,127,020 bp
  • A to G, chromosome 7 at 127,975,915 bp
  • T to C, chromosome 8 at 66,386,496 bp
  • T to C, chromosome 9 at 18,457,502 bp
  • T to A, chromosome 9 at 18,945,230 bp
  • T to A, chromosome 9 at 40,000,320 bp
  • T to C, chromosome 9 at 76,492,142 bp
  • CT to C, chromosome 9 at 104,186,805 bp
  • G to A, chromosome 9 at 121,263,638 bp
  • C to T, chromosome 10 at 76,178,095 bp
  • G to A, chromosome 10 at 77,561,216 bp
  • T to G, chromosome 10 at 130,472,185 bp
  • T to C, chromosome 11 at 87,782,046 bp
  • ACAGCAGCAGCAGCAGCAGCAGCAGCA to ACAGCAGCAGCAGCAGCAGCAGCA, chromosome 11 at 94,214,452 bp
  • G to A, chromosome 11 at 101,966,844 bp
  • T to C, chromosome 12 at 78,494,014 bp
  • A to G, chromosome 12 at 113,994,892 bp
  • T to A, chromosome 13 at 14,120,161 bp
  • T to C, chromosome 14 at 63,036,076 bp
  • A to G, chromosome 15 at 41,820,519 bp
  • C to T, chromosome 15 at 102,108,934 bp
  • A to G, chromosome 16 at 91,226,844 bp
  • T to A, chromosome 17 at 18,304,932 bp
  • T to A, chromosome 17 at 33,382,492 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4537 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041774-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.