Strain Name:
C57BL/6J-MtgxR4725Btlr/Mmmh
Stock Number:
041960-MU
Citation ID:
RRID:MMRRC_041960-MU
Other Names:
R4725 (G1), C57BL/6J-MtgxR4725Btlr
Major Collection:

Strain Information

Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223838
Homologene: 11808
Kcnj10
Name: potassium inwardly-rectifying channel, subfamily J, member 10
Synonyms: Kir1.2, BIRK-1, BIR10, Kir4.1, Kir4.1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16513
HGNC: HGNC:6256
Homologene: 1689
Ubn2
Name: ubinuclein 2
Synonyms: 6030408G03Rik, 2900060J04Rik, D130059P03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320538
Homologene: 45564
Dysf
Name: dysferlin
Synonyms: 2310004N10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 26903
HGNC: HGNC:3097
Homologene: 20748
Ulk2
Name: unc-51 like kinase 2
Synonyms: Unc51.2, A830085I22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 29869
Homologene: 5891
Dock1
Name: dedicator of cytokinesis 1
Synonyms: D630004B07Rik, 9130006G06Rik, Dock180, b2b3190Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330662
HGNC: HGNC:2987
Homologene: 55575
Slc44a2
Name: solute carrier family 44, member 2
Synonyms: 1110028E10Rik, CTL2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68682
VEGA: 9
Homologene: 10711
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: D130075K09Rik, lectomedin 3, LEC3, 5430402I23Rik, Lphn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Rtn4
Name: reticulon 4
Synonyms: 1110020G17Rik, C130026I10Rik, NOGO, NgA, Nogo-B, Nogo-A
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68585
Homologene: 10743
Nudcd3
Name: NudC domain containing 3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 209586
Homologene: 9097
Heatr1
Name: HEAT repeat containing 1
Synonyms: B130016L12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 217995
VEGA: 13
Homologene: 34562
Sucla2
Name: succinate-Coenzyme A ligase, ADP-forming, beta subunit
Synonyms: 4930547K18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 20916
Homologene: 2856
Bmal1
Name: basic helix-loop-helix ARNT like 1
Synonyms: Arnt3, MOP3, bHLHe5, Arntl
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11865
HGNC: HGNC:701
Homologene: 910
Zbtb40
Name: zinc finger and BTB domain containing 40
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230848
Homologene: 8912
Camta1
Name: calmodulin binding transcription activator 1
Synonyms: 2310058O09Rik, 1810059M14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100072
Homologene: 18942
Cep63
Name: centrosomal protein 63
Synonyms: CD20R, ET2, D9Mgc41, D9Mgc48e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 28135
Homologene: 11861
Drd3
Name: dopamine receptor D3
Synonyms: D3R, D3 receptor
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13490
VEGA: 16
HGNC: HGNC:3024
Homologene: 623
Pah
Name: phenylalanine hydroxylase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18478
HGNC: HGNC:8582
Homologene: 234
Scimp
Name: SLP adaptor and CSK interacting membrane protein
Synonyms: A430084P05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327957
Homologene: 52602
Plekhm2
Name: pleckstrin homology domain containing, family M (with RUN domain) member 2
Synonyms: 2310034J19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69582
Homologene: 19575
Ufsp1
Name: UFM1-specific peptidase 1
Synonyms: D5Ertd655e, 2700038N03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70240
Homologene: 80245
Cep192
Name: centrosomal protein 192
Synonyms: D430014P18Rik, 4631422C13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70799
VEGA: 18
Homologene: 73526
Kcnab3
Name: potassium voltage-gated channel, shaker-related subfamily, beta member 3
Synonyms: mKv(beta)4, Kcnab4, C330022D06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16499
HGNC: HGNC:6230
Homologene: 55844
Aldh1a1
Name: aldehyde dehydrogenase family 1, subfamily A1
Synonyms: ALDH1, E1, Ahd-2, Ahd2, Raldh1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11668
HGNC: HGNC:402
Homologene: 110441
Epha5
Name: Eph receptor A5
Synonyms: Cek7, bsk, Els1, Rek7, Hek7, Ehk1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13839
HGNC: HGNC:3389
Homologene: 55824
Dennd5b
Name: DENN domain containing 5B
Synonyms: 9330160C06Rik, D030011O10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320560
Homologene: 44911
Dchs1
Name: dachsous cadherin related 1
Synonyms: C130033F22Rik, 3110041P15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233651
Homologene: 2771
Loxhd1
Name: lipoxygenase homology domains 1
Synonyms: 1700096C21Rik, sba
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240411
Mroh4
Name: maestro heat-like repeat family member 4
Synonyms: 1700016M24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69439
Homologene: 72545
Fhad1
Name: forkhead-associated phosphopeptide binding domain 1
Synonyms: 2900090M10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329977
Homologene: 77947
Lrrc7
Name: leucine rich repeat containing 7
Synonyms: densin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242274
Homologene: 10817
Ccdc88b
Name: coiled-coil domain containing 88B
Synonyms: 2610041P08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 78317
VEGA: 19
Homologene: 49992
Dcaf10
Name: DDB1 and CUL4 associated factor 10
Synonyms: Wdr32
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242418
Homologene: 32581
Tnxb
Name: tenascin XB
Synonyms: Tnx, TN-MHC
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 81877
Homologene: 49589
Rabepk
Name: Rab9 effector protein with kelch motifs
Synonyms: 8430412M01Rik, 9530020D24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227746
Homologene: 48772
Hivep1
Name: human immunodeficiency virus type I enhancer binding protein 1
Synonyms: Cryabp1, alphaA-CRYBP1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110521
VEGA: 13
HGNC: HGNC:4920
Homologene: 1596
Gne
Name: glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Synonyms: 2310066H07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50798
Homologene: 3996
Gpat2
Name: glycerol-3-phosphate acyltransferase 2, mitochondrial
Synonyms: Gpat2, A530057A03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 215456
Homologene: 19037
Plekha6
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240753
Homologene: 135779
Pik3cg
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma
Synonyms: PI3Kgamma, p110gamma, PI3Kgamma, PI(3)Kgamma, 5830428L06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 30955
HGNC: HGNC:8978
Homologene: 68269
Erbb2
Name: erb-b2 receptor tyrosine kinase 2
Synonyms: Neu, Neu oncogene, c-erbB2, HER-2, ErbB-2, HER2, c-neu, l11Jus8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13866
HGNC: HGNC:3430
Homologene: 3273
Mast1
Name: microtubule associated serine/threonine kinase 1
Synonyms: 9430008B02Rik, SAST170, SAST
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56527
Homologene: 10543
Spag6l
Name: sperm associated antigen 6-like
Synonyms: PF16, Spag6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 50525
Homologene: 8252
Sgip1
Name: SH3-domain GRB2-like (endophilin) interacting protein 1
Synonyms: 3110007P09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73094
Homologene: 13001
Smpdl3b
Name: sphingomyelin phosphodiesterase, acid-like 3B
Synonyms: 1110054A24Rik, Asml3b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100340
Homologene: 8708
Pira13
Name: paired-Ig-like receptor A13
Synonyms: ENSMUSG00000074419, Gm15448
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100041146
Homologene: 134028
Lcmt2
Name: leucine carboxyl methyltransferase 2
Synonyms: Tyw4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329504
Homologene: 19642
Rusc1
Name: RUN and SH3 domain containing 1
Synonyms: 2210403N08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72296
Homologene: 75028
Samsn1
Name: SAM domain, SH3 domain and nuclear localization signals, 1
Synonyms: 4930571B16Rik, Hacs1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67742
Homologene: 11148
Ceacam5
Name: CEA cell adhesion molecule 5
Synonyms: 1600029H12Rik, Psg30
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73250
HGNC: HGNC:1819
Homologene: 115938
Ganc
Name: glucosidase, alpha; neutral C
Synonyms: 5830445O15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76051
HGNC: HGNC:4139
Homologene: 25627
Npdc1
Name: neural proliferation, differentiation and control 1
Synonyms: NPDC-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18146
HGNC: HGNC:7899
Homologene: 32050
Serpinb13
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13
Synonyms: headpin, PI13, HURPIN, HUR7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241196
HGNC: HGNC:8944
Homologene: 22718
Ctdsp1
Name: CTD small phosphatase 1
Synonyms: SCP1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227292
Homologene: 100834
Gpr33
Name: G protein-coupled receptor 33
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14762
HGNC: HGNC:4489
Homologene: 7345
Cldn12
Name: claudin 12
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 64945
HGNC: HGNC:2034
Homologene: 40809
Gm5830
Name: predicted pseudogene 5830
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545332
Gm10475
Name: predicted gene 10475
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Gm16108
Name: predicted gene 16108
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 102637926
VEGA: 5
Trbv14
Name: T cell receptor beta, variable 14
Synonyms: BV13S1, Gm16910, Tcrb-V13
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 100124678
Igkv2-112
Name: immunoglobulin kappa variable 2-112
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381776
Gm6096
Name: predicted gene 6096
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
5830454E08Rik
Name: RIKEN cDNA 5830454E08 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 76100
VEGA: 9
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 74,394,664 bp
  • T to A, chromosome 1 at 78,967,832 bp
  • C to T, chromosome 1 at 106,982,844 bp
  • C to A, chromosome 1 at 133,283,320 bp
  • T to A, chromosome 1 at 172,369,159 bp
  • G to A, chromosome 2 at 25,408,945 bp
  • T to C, chromosome 2 at 34,795,308 bp
  • T to C, chromosome 2 at 120,435,273 bp
  • C to G, chromosome 2 at 121,139,430 bp
  • T to C, chromosome 2 at 127,431,982 bp
  • A to G, chromosome 3 at 89,091,429 bp
  • GAAGTTGTTTGGAGATTCTTATCTTA to GA, chromosome 3 at 158,318,408 bp
  • A to G, chromosome 4 at 44,066,806 bp
  • G to A, chromosome 4 at 45,372,769 bp
  • A to G, chromosome 4 at 102,966,222 bp
  • T to C, chromosome 4 at 132,745,178 bp
  • A to G, chromosome 4 at 137,018,761 bp
  • G to A, chromosome 4 at 141,639,806 bp
  • A to T, chromosome 4 at 141,928,378 bp
  • A to G, chromosome 4 at 151,148,496 bp
  • A to G, chromosome 5 at 5,508,385 bp
  • T to C, chromosome 5 at 21,910,952 bp
  • T to C, chromosome 5 at 81,766,205 bp
  • T to C, chromosome 5 at 84,233,917 bp
  • G to T, chromosome 5 at 114,065,485 bp
  • T to C, chromosome 5 at 137,295,307 bp
  • A to G, chromosome 6 at 38,522,305 bp
  • A to G, chromosome 6 at 41,135,398 bp
  • A to C, chromosome 6 at 68,220,466 bp
  • A to T, chromosome 6 at 84,097,756 bp
  • A to G, chromosome 6 at 149,044,779 bp
  • A to C, chromosome 7 at 3,821,548 bp
  • T to C, chromosome 7 at 17,760,677 bp
  • G to T, chromosome 7 at 34,251,059 bp
  • T to C, chromosome 7 at 105,755,253 bp
  • C to G, chromosome 7 at 105,765,552 bp
  • C to A, chromosome 7 at 113,304,359 bp
  • T to A, chromosome 7 at 134,745,014 bp
  • A to G, chromosome 8 at 84,929,006 bp
  • G to A, chromosome 9 at 21,348,395 bp
  • T to C, chromosome 9 at 102,590,556 bp
  • T to C, chromosome 9 at 120,577,703 bp
  • T to A, chromosome 10 at 87,554,376 bp
  • A to T, chromosome 11 at 6,193,475 bp
  • T to A, chromosome 11 at 29,708,362 bp
  • A to G, chromosome 11 at 61,791,486 bp
  • A to G, chromosome 11 at 69,330,468 bp
  • A to G, chromosome 11 at 70,800,713 bp
  • A to G, chromosome 11 at 98,425,144 bp
  • A to T, chromosome 12 at 32,193,597 bp
  • A to G, chromosome 12 at 52,024,109 bp
  • C to T, chromosome 13 at 12,424,662 bp
  • A to G, chromosome 13 at 42,163,411 bp
  • T to A, chromosome 14 at 73,568,989 bp
  • A to G, chromosome 15 at 74,616,107 bp
  • T to C, chromosome 15 at 94,351,762 bp
  • A to T, chromosome 16 at 16,792,531 bp
  • G to T, chromosome 16 at 43,822,801 bp
  • A to T, chromosome 16 at 75,945,329 bp
  • A to T, chromosome 17 at 34,699,067 bp
  • A to C, chromosome 18 at 67,816,766 bp
  • T to A, chromosome 18 at 77,395,457 bp
  • C to T, chromosome 19 at 6,857,113 bp
  • T to A, chromosome 19 at 20,640,081 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4725 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041960-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.