Strain Name:
C57BL/6J-MtgxR5370Btlr/Mmmh
Stock Number:
042947-MU
Citation ID:
RRID:MMRRC_042947-MU
Other Names:
R5370 (G1), C57BL/6J-MtgxR5370Btlr
Major Collection:

Strain Information

Stam2
Name: signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Synonyms: Hbp, 1200004O12Rik, 5730456G07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56324
Homologene: 68490
Fam169a
Name: family with sequence similarity 169, member A
Synonyms: B230112C05Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 320557
VEGA: 13
Homologene: 52656
Dip2b
Name: disco interacting protein 2 homolog B
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239667
Homologene: 72227
Ptpn23
Name: protein tyrosine phosphatase, non-receptor type 23
Synonyms: PTP-TD14
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 104831
Homologene: 135706
Heatr1
Name: HEAT repeat containing 1
Synonyms: B130016L12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 217995
VEGA: 13
Homologene: 34562
Abcb8
Name: ATP-binding cassette, sub-family B member 8
Synonyms: 4833412N02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74610
HGNC: HGNC:49
Homologene: 5203
Ass1
Name: argininosuccinate synthetase 1
Synonyms: ASS, Ass-1, fold
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11898
HGNC: HGNC:758
Homologene: 6899
Leng8
Name: leukocyte receptor cluster (LRC) member 8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232798
Homologene: 13612
Hjurp
Name: Holliday junction recognition protein
Synonyms: C330011F01Rik, A730008H23Rik, 6430706D22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381280
Homologene: 10184
Clec4g
Name: C-type lectin domain family 4, member g
Synonyms: 4930572L20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75863
Homologene: 18879
Pros1
Name: protein S (alpha)
Synonyms: protein S
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19128
HGNC: HGNC:9456
Homologene: 264
Hs6st1
Name: heparan sulfate 6-O-sulfotransferase 1
Synonyms: 6OST1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 50785
HGNC: HGNC:5201
Homologene: 75051
Nxf1
Name: nuclear RNA export factor 1
Synonyms: Tip associated protein, TAP, Mex67, Mvb1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 53319
HGNC: HGNC:8071
Homologene: 38176
Rnf115
Name: ring finger protein 115
Synonyms: 2610028E05Rik, Zfp364, Rabring7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67845
Homologene: 69167
Naa20
Name: N(alpha)-acetyltransferase 20, NatB catalytic subunit
Synonyms: 2900026I01Rik, 1500004D14Rik, D2Ertd186e, Nat5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67877
Homologene: 7165
Muc19
Name: mucin 19
Synonyms: apomucin, sld
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239611
Rhoh
Name: ras homolog family member H
Synonyms: 5830400A04Rik, Arhh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74734
HGNC: HGNC:686
Homologene: 3180
Ttn
Name: titin
Synonyms: connectin, L56, 1100001C23Rik, mdm, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Ephb2
Name: Eph receptor B2
Synonyms: eteck, Erk, Tyro5, Prkm5, Nuk, Drt, Hek5, Sek3, Qek5, Cek5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13844
HGNC: HGNC:3393
Homologene: 37925
Taf5
Name: TATA-box binding protein associated factor 5
Synonyms: 6330528C20Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226182
VEGA: 19
Homologene: 5064
Dner
Name: delta/notch-like EGF repeat containing
Synonyms: BET, A930026D19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227325
Homologene: 26722
Armc3
Name: armadillo repeat containing 3
Synonyms: 4921513G22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70882
Homologene: 31589
Xirp2
Name: xin actin-binding repeat containing 2
Synonyms: A530024P18Rik, 2310008C07Rik, 2310003D02Rik, mXin beta, myomaxin, Cmya3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241431
Homologene: 19388
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Wnk2
Name: WNK lysine deficient protein kinase 2
Synonyms: ESTM15, 1810073P09Rik, X83337
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75607
Homologene: 19155
Cdhr2
Name: cadherin-related family member 2
Synonyms: LOC268663, Pcdh24
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 268663
Homologene: 134510
Gsdme
Name: gasdermin E
Synonyms: 4932441K13Rik, 2310037D07Rik, Fin15, Dfna5h, Dfna5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54722
HGNC: HGNC:2810
Homologene: 3242
Myom2
Name: myomesin 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17930
HGNC: HGNC:7614
Homologene: 2953
Vmn2r104
Name: vomeronasal 2, receptor 104
Synonyms: V2r7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22313
Homologene: 129751
Vwa5a
Name: von Willebrand factor A domain containing 5A
Synonyms: BCSC-1, 5830475I06Rik, Loh11cr2a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67776
HGNC: HGNC:6658
Homologene: 18222
Vmn2r11
Name: vomeronasal 2, receptor 11
Synonyms: EG384219
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384219
Homologene: 129606
Or2n1d
Name: olfactory receptor family 2 subfamily N member 1D
Synonyms: GA_x6K02T2PSCP-2779375-2780313, MOR256-7, Olfr136
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258803
Homologene: 119758
Padi3
Name: peptidyl arginine deiminase, type III
Synonyms: PAD type III, Pad3, Pdi3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18601
Homologene: 7882
Mapk13
Name: mitogen-activated protein kinase 13
Synonyms: p38 delta MAP kinase, SAPK4, Serk4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26415
HGNC: HGNC:6875
Homologene: 48133
Ggcx
Name: gamma-glutamyl carboxylase
Synonyms: vitamin K-dependent carboxylase
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56316
HGNC: HGNC:4247
Homologene: 639
Mrgprb8
Name: MAS-related GPR, member B8
Synonyms: MrgB8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404240
Homologene: 83620
Zpbp2
Name: zona pellucida binding protein 2
Synonyms: 1700017D11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69376
Homologene: 18892
Gzma
Name: granzyme A
Synonyms: serine esterase 1, TSP1, BLT esterase, Hanukah factor, Ctla-3, Hf, Ctla3, H factor, SE1, TSP-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14938
VEGA: 13
HGNC: HGNC:4708
Homologene: 21237
Gm10634
Name: predicted gene 10634
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 100039674
Homologene: 132183
Ighv3-5
Name: immunoglobulin heavy variable 3-5
Synonyms: Gm7112
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 633457
Pcdhga3
Name: protocadherin gamma subfamily A, 3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93711
HGNC: HGNC:8701
Homologene: 75100
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 36,069,081 bp
  • CGCTGCTGCTGCTGCTGCTGCTGCTGC to CGCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 84,585,549 bp
  • GT to GTT, chromosome 1 at 88,266,524 bp
  • A to C, chromosome 2 at 19,286,062 bp
  • G to A, chromosome 2 at 31,518,733 bp
  • G to A, chromosome 2 at 52,736,293 bp
  • A to G, chromosome 2 at 67,512,152 bp
  • A to T, chromosome 2 at 76,811,243 bp
  • A to G, chromosome 2 at 145,912,333 bp
  • A to G, chromosome 3 at 96,758,020 bp
  • T to C, chromosome 4 at 136,771,570 bp
  • C to A, chromosome 4 at 140,810,538 bp
  • C to T, chromosome 5 at 24,400,139 bp
  • G to T, chromosome 5 at 65,892,578 bp
  • T to C, chromosome 5 at 109,047,555 bp
  • T to A, chromosome 6 at 50,229,306 bp
  • T to C, chromosome 6 at 72,425,931 bp
  • A to G, chromosome 7 at 4,145,434 bp
  • A to T, chromosome 7 at 48,388,820 bp
  • C to A, chromosome 8 at 3,718,344 bp
  • G to A, chromosome 8 at 15,099,343 bp
  • A to G, chromosome 9 at 38,741,216 bp
  • A to G, chromosome 9 at 88,803,819 bp
  • A to G, chromosome 9 at 110,385,701 bp
  • T to A, chromosome 11 at 66,029,354 bp
  • C to T, chromosome 11 at 98,555,560 bp
  • A to G, chromosome 12 at 114,262,898 bp
  • T to A, chromosome 13 at 12,401,522 bp
  • T to C, chromosome 13 at 49,102,961 bp
  • A to G, chromosome 13 at 54,720,887 bp
  • T to A, chromosome 13 at 97,106,962 bp
  • T to A, chromosome 13 at 113,095,795 bp
  • T to C, chromosome 15 at 91,898,112 bp
  • C to T, chromosome 15 at 100,211,986 bp
  • A to T, chromosome 16 at 62,913,976 bp
  • A to T, chromosome 17 at 20,030,188 bp
  • T to A, chromosome 17 at 28,776,352 bp
  • G to T, chromosome 17 at 38,335,444 bp
  • T to A, chromosome 18 at 37,675,290 bp
  • A to G, chromosome 19 at 8,772,140 bp
  • A to G, chromosome 19 at 47,075,764 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5370 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042947-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.