Strain Name:
C57BL/6J-MtgxR5403Btlr/Mmmh
Stock Number:
042974-MU
Citation ID:
RRID:MMRRC_042974-MU
Other Names:
R5403 (G1), C57BL/6J-MtgxR5403Btlr
Major Collection:

Strain Information

Mrtfb
Name: myocardin related transcription factor B
Synonyms: MRTF-B, Gt4-1, Mrtfb, Mkl2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239719
Homologene: 40917
Dennd2b
Name: DENN domain containing 2B
Synonyms: 2610305K15Rik, 2010004M01Rik, St5, Denn2b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76954
Homologene: 3951
Cdr2
Name: cerebellar degeneration-related 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12585
HGNC: HGNC:1799
Homologene: 7262
Sema4b
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
Synonyms: SemC, Semac
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20352
Homologene: 8426
Ddx50
Name: DExD box helicase 50
Synonyms: GU2, RH-II/Gubeta, 4933429B04Rik, 8430408E17Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 50
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 94213
VEGA: 10
Homologene: 56986
Ube2o
Name: ubiquitin-conjugating enzyme E2O
Synonyms: B230113M03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217342
Homologene: 11113
Alkbh8
Name: alkB homolog 8, tRNA methyltransferase
Synonyms: 8030431D03Rik, 9430088N01Rik, 4930562C03Rik, Abh8
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67667
Homologene: 44488
Brd7
Name: bromodomain containing 7
Synonyms: bromodomain protein 75 kDa, BP75, CELTIX1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26992
Homologene: 8085
Ttc3
Name: tetratricopeptide repeat domain 3
Synonyms: TPRD, D16Ium21, 2610202A04Rik, D16Ium21e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22129
Homologene: 2487
Tbcd
Name: tubulin-specific chaperone d
Synonyms: A030005L14Rik, 2310057L06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108903
Homologene: 4368
Zfp106
Name: zinc finger protein 106
Synonyms: Cd-1, H3a, sirm, Sh3bp3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20402
Homologene: 40787
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Bicd1
Name: BICD cargo adaptor 1
Synonyms: B830009D06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12121
HGNC: HGNC:1049
Homologene: 37518
Rad50
Name: RAD50 double strand break repair protein
Synonyms: Rad50l, Mrell
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19360
HGNC: HGNC:9816
Homologene: 38092
T2
Name: brachyury 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21331
Homologene: 86977
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: l(7)-3Rn, Ten-m4, Doc4, l7Rn3, ELM2, Odz4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23966
Homologene: 8034
Anp32a
Name: acidic nuclear phosphoprotein 32 family member A
Synonyms: pp32, Anp32
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11737
Homologene: 137229
Clhc1
Name: clathrin heavy chain linker domain containing 1
Synonyms: 1700034F02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73324
Homologene: 17569
Phf24
Name: PHD finger protein 24
Synonyms: N28178, GINIP
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230085
Homologene: 18208
Epha6
Name: Eph receptor A6
Synonyms: m-ehk2, Ehk2, Hek12
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13840
Homologene: 56396
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Cops8
Name: COP9 signalosome subunit 8
Synonyms: Csn8, 9430009J09Rik, Sgn8
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108679
Homologene: 4882
Robo4
Name: roundabout guidance receptor 4
Synonyms: 1200012D01Rik, Magic roundabout
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74144
Homologene: 10397
Mgat5b
Name: mannoside acetylglucosaminyltransferase 5, isoenzyme B
Synonyms: GnT-IX
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268510
Homologene: 27821
Opn4
Name: opsin 4 (melanopsin)
Synonyms: 1110007J02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 30044
VEGA: 14
Homologene: 69152
Tnip2
Name: TNFAIP3 interacting protein 2
Synonyms: ABIN-2, 1810020H16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231130
Homologene: 11515
Adamts6
Name: ADAM metallopeptidase with thrombospondin type 1 motif 6
Synonyms: ADAM-TS6, A930019D11Rik, b2b1879.1Clo, b2b2228Clo, b2b2187.1Clo, b2b2182Clo, b2b2029Clo
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 108154
VEGA: 13
HGNC: HGNC:222
Homologene: 82573
Ptprd
Name: protein tyrosine phosphatase receptor type D
Synonyms: 3000002J10Rik, B230219D21Rik, 1110002J03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19266
HGNC: HGNC:9668
Chd3
Name: chromodomain helicase DNA binding protein 3
Synonyms: Mi-2 alpha, Prp9-1, Prp7, 2600010P09Rik, Chd7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216848
HGNC: HGNC:1918
Homologene: 62693
Hc
Name: hemolytic complement
Synonyms: C5a, C5, He, Hfib2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15139
HGNC: HGNC:1331
Homologene: 20412
Ccdc88b
Name: coiled-coil domain containing 88B
Synonyms: 2610041P08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 78317
VEGA: 19
Homologene: 49992
Naip6
Name: NLR family, apoptosis inhibitory protein 6
Synonyms: Naip-rs4A, Naip-rs4, Birc1f
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17952
HGNC: HGNC:7634
Homologene: 113589
Adcy8
Name: adenylate cyclase 8
Synonyms: AC8
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11514
VEGA: 15
HGNC: HGNC:239
Homologene: 37443
Zfp607a
Name: zinc finger protein 607A
Synonyms: 4732475C15Rik, Zfp607
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545938
Homologene: 134321
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 628870
Homologene: 46008
Mroh5
Name: maestro heat-like repeat family member 5
Synonyms: LOC268816, Gm628
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268816
Bpifb4
Name: BPI fold containing family B, member 4
Synonyms: LOC381399, Gm1006
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381399
Homologene: 66971
Csmd2
Name: CUB and Sushi multiple domains 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329942
Homologene: 89034
Zmynd10
Name: zinc finger, MYND domain containing 10
Synonyms: Blu
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 114602
Homologene: 9293
Ces1e
Name: carboxylesterase 1E
Synonyms: Eg, Es-22, egasyn, Es22
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13897
HGNC: HGNC:1863
Homologene: 115660
Acsbg3
Name: acyl-CoA synthetase bubblegum family member 3
Synonyms: 1700061G19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78625
Homologene: 28378
Jmy
Name: junction-mediating and regulatory protein
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 57748
VEGA: 13
Homologene: 10955
Zfp687
Name: zinc finger protein 687
Synonyms: 4931408L03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 78266
Homologene: 10827
Cd46
Name: CD46 antigen, complement regulatory protein
Synonyms: CD46, Mcp
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17221
HGNC: HGNC:6953
Homologene: 7832
Cntnap3
Name: contactin associated protein-like 3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238680
VEGA: 13
Homologene: 129602
Insyn2b
Name: inhibitory synaptic factor family member 2B
Synonyms: Gm6041, Fam196b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 574403
VEGA: 11
Homologene: 107175
Ttll11
Name: tubulin tyrosine ligase-like family, member 11
Synonyms: 4932702F08Rik, D2Ertd624e, 4933424A20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74410
Homologene: 77534
Brinp1
Name: bone morphogenic protein/retinoic acid inducible neural specific 1
Synonyms: Dbccr1, Fam5a, Dbc1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56710
HGNC: HGNC:2687
Homologene: 8754
Asb18
Name: ankyrin repeat and SOCS box-containing 18
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208372
Homologene: 16382
Fndc9
Name: fibronectin type III domain containing 9
Synonyms: C030019I05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320116
Homologene: 37404
Gpx6
Name: glutathione peroxidase 6
Synonyms: olfactory, 1700020G18Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75512
HGNC: HGNC:4558
Homologene: 130008
Emc9
Name: ER membrane protein complex subunit 9
Synonyms: Cgi112, 1500005A01Rik, Fam158a
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 85308
Homologene: 41095
Pheta1
Name: PH domain containing endocytic trafficking adaptor 1
Synonyms: A230106M15Rik, Ses1, Fam109a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231717
Homologene: 16966
Dlg2
Name: discs large MAGUK scaffold protein 2
Synonyms: PSD93, Chapsyn-110, B330007M19Rik, A330103J02Rik, LOC382816, Dlgh2, B230218P12Rik, Gm21505
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23859
HGNC: HGNC:2901
Homologene: 1046
Or6b2
Name: olfactory receptor family 6 subfamily B member 2
Synonyms: GA_x6K02T2R7CC-81277975-81278913, MOR103-3, Olfr1416
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 259040
Homologene: 17472
Ppargc1a
Name: peroxisome proliferative activated receptor, gamma, coactivator 1 alpha
Synonyms: Pgc1, PPAR Gamma Coactivator-1, Pgco1, Pgc-1alpha, Pgc-1alphaa, A830037N07Rik, Gm11133
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19017
HGNC: HGNC:9237
Homologene: 7485
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, CKLFH1, Cklfsf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Krtap4-7
Name: keratin associated protein 4-7
Synonyms: KRTAP4.7, KAP4.7, 2310037K05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76444
Homologene: 137394
Or8g22
Name: olfactory receptor family 8 subfamily G member 22, pseudogene 1
Synonyms: GA_x6K02T2PVTD-32743332-32742397, MOR171-37, EG628171, Olfr936
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 100503486
VEGA: 9
Tfap2e
Name: transcription factor AP-2, epsilon
Synonyms: AP-2e, Tcfap2e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 332937
Homologene: 2422
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 90,014,388 bp
  • C to T, chromosome 1 at 90,606,620 bp
  • A to T, chromosome 1 at 92,480,297 bp
  • C to T, chromosome 1 at 195,062,411 bp
  • A to G, chromosome 2 at 35,057,434 bp
  • G to A, chromosome 2 at 35,940,731 bp
  • T to C, chromosome 2 at 120,534,781 bp
  • A to T, chromosome 2 at 153,943,992 bp
  • T to C, chromosome 3 at 95,008,711 bp
  • A to T, chromosome 4 at 42,933,831 bp
  • A to G, chromosome 4 at 68,792,964 bp
  • G to A, chromosome 4 at 75,954,168 bp
  • T to C, chromosome 4 at 126,734,646 bp
  • C to T, chromosome 4 at 128,486,884 bp
  • A to G, chromosome 5 at 34,513,764 bp
  • G to A, chromosome 5 at 51,462,825 bp
  • A to G, chromosome 5 at 121,852,731 bp
  • A to G, chromosome 6 at 149,556,760 bp
  • A to G, chromosome 7 at 27,879,319 bp
  • G to A, chromosome 7 at 80,198,652 bp
  • A to G, chromosome 7 at 92,431,002 bp
  • A to G, chromosome 7 at 96,888,827 bp
  • GCG to GCGACGGCGACG, chromosome 7 at 97,579,907 bp
  • T to C, chromosome 7 at 104,769,234 bp
  • A to G, chromosome 7 at 109,556,905 bp
  • G to A, chromosome 7 at 120,958,745 bp
  • G to T, chromosome 8 at 88,357,541 bp
  • T to G, chromosome 8 at 93,208,612 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to G, chromosome 9 at 3,385,318 bp
  • CGG to CG, chromosome 9 at 37,411,490 bp
  • G to T, chromosome 9 at 39,046,703 bp
  • A to T, chromosome 9 at 62,341,993 bp
  • T to A, chromosome 9 at 107,550,586 bp
  • A to G, chromosome 10 at 62,647,030 bp
  • T to A, chromosome 10 at 107,808,756 bp
  • A to G, chromosome 11 at 29,578,244 bp
  • A to T, chromosome 11 at 34,403,058 bp
  • C to T, chromosome 11 at 46,237,714 bp
  • A to G, chromosome 11 at 53,695,281 bp
  • A to T, chromosome 11 at 69,349,069 bp
  • A to T, chromosome 11 at 99,643,714 bp
  • A to T, chromosome 11 at 116,548,807 bp
  • T to G, chromosome 11 at 116,948,657 bp
  • C to A, chromosome 11 at 121,560,743 bp
  • A to G, chromosome 13 at 21,317,643 bp
  • G to A, chromosome 13 at 64,761,978 bp
  • G to T, chromosome 13 at 93,441,396 bp
  • G to A, chromosome 13 at 100,300,077 bp
  • A to G, chromosome 13 at 104,352,815 bp
  • T to C, chromosome 14 at 34,592,937 bp
  • C to G, chromosome 14 at 55,585,112 bp
  • C to T, chromosome 15 at 64,716,152 bp
  • TGGAG to TG, chromosome 15 at 73,783,074 bp
  • A to G, chromosome 16 at 13,401,013 bp
  • A to T, chromosome 16 at 59,775,570 bp
  • T to C, chromosome 16 at 94,459,844 bp
  • A to T, chromosome 17 at 8,418,003 bp
  • G to A, chromosome 17 at 30,748,568 bp
  • G to T, chromosome 17 at 56,876,221 bp
  • T to A, chromosome 19 at 6,857,740 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5403 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042974-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.