Strain Name:
C57BL/6J-MtgxR6685Btlr/Mmmh
Stock Number:
044804-MU
Citation ID:
RRID:MMRRC_044804-MU
Other Names:
R6685 (G1)
Major Collection:

Strain Information

Zfp42
Name: zinc finger protein 42
Synonyms: Rex1, Rex-1, Zfp-42
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22702
Homologene: 7601
Etaa1
Name: Ewing tumor-associated antigen 1
Synonyms: 5730466H23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68145
Homologene: 10369
Metap1
Name: methionyl aminopeptidase 1
Synonyms: 1700029C17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75624
Homologene: 6488
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, 4832420A03Rik, Hbxap, C030033M12Rik, XAP8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Cttnbp2nl
Name: CTTNBP2 N-terminal like
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80281
Homologene: 36371
Tmem161b
Name: transmembrane protein 161B
Synonyms: 2810446P07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72745
Homologene: 14519
Txnrd3
Name: thioredoxin reductase 3
Synonyms: Tgr, TR2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232223
Homologene: 60033
Casc3
Name: exon junction complex subunit
Synonyms: Btz, Mln51
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192160
Homologene: 7208
Ehbp1
Name: EH domain binding protein 1
Synonyms: KIAA0903-like, Flj21950
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216565
Homologene: 22880
Slc9a2
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 2
Synonyms: NHE2, 4932415O19Rik, 2210416H12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226999
Homologene: 20661
Peg10
Name: paternally expressed 10
Synonyms: MyEF-3 like, Mar2, Mart2, MEF3L, HB-1, MyEF-3, Edr, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Dsg3
Name: desmoglein 3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13512
VEGA: 18
HGNC: HGNC:3050
Homologene: 55513
Or51a6
Name: olfactory receptor family 51 subfamily A member 6
Synonyms: GA_x6K02T2PBJ9-5666843-5665908, MOR8-1, Olfr575
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259118
Homologene: 122786
Adgrb3
Name: adhesion G protein-coupled receptor B3
Synonyms: A830096D10Rik, Bai3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210933
HGNC: HGNC:945
Homologene: 1289
Poteg
Name: POTE ankyrin domain family, member G
Synonyms: 4930456F22Rik, 4921537P18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70952
Homologene: 134158
Flg
Name: filaggrin
Synonyms: ft, profilaggrin, fillagrin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14246
VEGA: 3
Adcy5
Name: adenylate cyclase 5
Synonyms: AC5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224129
VEGA: 16
HGNC: HGNC:236
Homologene: 11213
Inhbb
Name: inhibin beta-B
Synonyms: activin beta-B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16324
HGNC: HGNC:6067
Homologene: 1654
Slc26a7
Name: solute carrier family 26, member 7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 208890
Homologene: 13770
Mcm8
Name: minichromosome maintenance 8 homologous recombination repair factor
Synonyms: 5730432L01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66634
Homologene: 12001
Ccn5
Name: cellular communication network factor 5
Synonyms: Wisp2, Crgr4, rCop1, CCN5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22403
Homologene: 2882
Sh3rf3
Name: SH3 domain containing ring finger 3
Synonyms: 4831416G18Rik, Sh3md4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237353
Homologene: 77551
Acox1
Name: acyl-Coenzyme A oxidase 1, palmitoyl
Synonyms: D130055E20Rik, AOX, Acyl-CoA oxidase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11430
HGNC: HGNC:119
Homologene: 38299
Dcst1
Name: DC-STAMP domain containing 1
Synonyms: A330106H01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77772
Homologene: 14981
Gpr162
Name: G protein-coupled receptor 162
Synonyms: A-2, Grca
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14788
Homologene: 8400
Lkaaear1
Name: LKAAEAR motif containing 1 (IKAAEAR murine motif)
Synonyms: LOC277496, 4930526D03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277496
Homologene: 52380
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 25,111,736 bp
  • A to T, chromosome 1 at 40,718,909 bp
  • A to G, chromosome 1 at 119,417,605 bp
  • G to A, chromosome 2 at 132,842,650 bp
  • A to G, chromosome 2 at 163,828,948 bp
  • TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG to TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG, chromosome 2 at 181,697,561 bp
  • A to C, chromosome 3 at 89,356,873 bp
  • T to C, chromosome 3 at 93,279,409 bp
  • G to T, chromosome 3 at 105,005,498 bp
  • A to T, chromosome 3 at 138,478,834 bp
  • C to A, chromosome 4 at 14,593,819 bp
  • A to T, chromosome 4 at 14,593,820 bp
  • T to A, chromosome 6 at 4,754,738 bp
  • G to A, chromosome 6 at 89,669,915 bp
  • A to G, chromosome 6 at 124,861,531 bp
  • CG to CGACGGCGGTG, chromosome 7 at 97,579,908 bp
  • T to C, chromosome 7 at 102,955,681 bp
  • T to A, chromosome 8 at 27,447,905 bp
  • G to A, chromosome 8 at 43,296,056 bp
  • C to T, chromosome 10 at 59,086,841 bp
  • G to T, chromosome 11 at 17,953,582 bp
  • A to G, chromosome 11 at 22,146,641 bp
  • A to G, chromosome 11 at 98,822,530 bp
  • G to T, chromosome 11 at 116,180,348 bp
  • C to A, chromosome 13 at 84,222,418 bp
  • A to G, chromosome 16 at 35,279,216 bp
  • G to A, chromosome 18 at 20,520,615 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6685 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044804-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.