Strain Name:
C57BL/6J-MtgxR7317Btlr/Mmmh
Stock Number:
045369-MU
Citation ID:
RRID:MMRRC_045369-MU
Other Names:
R7317 (G1)
Major Collection:

Strain Information

Uso1
Name: USO1 vesicle docking factor
Synonyms: Vdp, transcytosis associated protein p115, TAP
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56041
Homologene: 2754
Htr5b
Name: 5-hydroxytryptamine (serotonin) receptor 5B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15564
Homologene: 74951
Mbd5
Name: methyl-CpG binding domain protein 5
Synonyms: 9430004D19Rik, OTTMUSG00000012483, C030040A15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109241
Homologene: 81861
Tert
Name: telomerase reverse transcriptase
Synonyms: TR
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21752
VEGA: 13
Homologene: 31141
Utp20
Name: UTP20 small subunit processome component
Synonyms: DRIM, 3830408P06Rik, mDRIM
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Fubp3
Name: far upstream element (FUSE) binding protein 3
Synonyms: A330051M14Rik, Marta2, FBP3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320267
HGNC: HGNC:4005
Homologene: 45954
Pdzd2
Name: PDZ domain containing 2
Synonyms: LOC223364, 4930537L06Rik, Pdzk3, A930022H17Rik, Gm21706
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68070
Homologene: 23393
Chd1
Name: chromodomain helicase DNA binding protein 1
Synonyms: 4930525N21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12648
HGNC: HGNC:1915
Homologene: 68174
Usp5
Name: ubiquitin specific peptidase 5 (isopeptidase T)
Synonyms: Ucht
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22225
Homologene: 55758
Pi4ka
Name: phosphatidylinositol 4-kinase alpha
Synonyms: Pik4ca
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224020
HGNC: HGNC:8983
Homologene: 11171
Med15
Name: mediator complex subunit 15
Synonyms: A230074L19Rik, Pcqap
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 94112
VEGA: 16
Mon2
Name: MON2 homolog, regulator of endosome to Golgi trafficking
Synonyms: SF21, 2610528O22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67074
VEGA: 10
Homologene: 44309
Arap2
Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
Synonyms: Centd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 212285
Homologene: 9064
Gspt1
Name: G1 to S phase transition 1
Synonyms: Gst-1, Gst-1, G1st
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14852
HGNC: HGNC:4621
Homologene: 68226
Bicd2
Name: BICD cargo adaptor 2
Synonyms: 0610027D24Rik, 1110005D12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76895
VEGA: 13
Homologene: 9070
Cluh
Name: clustered mitochondria homolog
Synonyms: 1300001I01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74148
Homologene: 9063
Pex1
Name: peroxisomal biogenesis factor 1
Synonyms: 5430414H02Rik, ZWS1, E330005K07Rik, peroxisome biogenesis factor 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71382
HGNC: HGNC:8850
Homologene: 27006
Cdc42bpg
Name: CDC42 binding protein kinase gamma
Synonyms: MRCKgamma
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240505
Homologene: 28384
Amotl1
Name: angiomotin-like 1
Synonyms: 2310067L22Rik, 4932416D09Rik, JEAP, 2310010G08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75723
Homologene: 43977
Gabbr1
Name: gamma-aminobutyric acid type B receptor subunit 1
Synonyms: GABAB1, GABAbR1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 54393
HGNC: HGNC:4070
Homologene: 1132
Gm14496
Name: predicted gene 14496
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 672125
Homologene: 129606
Tnc
Name: tenascin C
Synonyms: C130033P17Rik, TN, hexabrachion, Hxb, cytotactin, tenascin-C, TN-C
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21923
HGNC: HGNC:5318
Homologene: 55636
C1qtnf6
Name: C1q and tumor necrosis factor related protein 6
Synonyms: CTRP6, 2810036M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72709
Homologene: 12481
Sidt2
Name: SID1 transmembrane family, member 2
Synonyms: CGI-40
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214597
Homologene: 22943
Msh3
Name: mutS homolog 3
Synonyms: D13Em1, Rep3, Rep-3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17686
HGNC: HGNC:7326
Homologene: 1829
R3hcc1l
Name: R3H domain and coiled-coil containing 1 like
Synonyms: D19Ertd386e, 1700036B12Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 52013
Homologene: 8707
Stau2
Name: staufen double-stranded RNA binding protein 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 29819
Homologene: 8666
Mapk8ip3
Name: mitogen-activated protein kinase 8 interacting protein 3
Synonyms: Syd2, Jip3, JNK-interacting protein 3, JUN/SAPK-associated protein 1, JSAP1d, JSAP1c, JSAP1b, JSAP1a, c-Jun NH2-terminal kinase (JNK)/stress-activated protein kinase-associated protein 1, JSAP1, sunday driver 2, D17Wsu15e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 30957
HGNC: HGNC:6884
Homologene: 22790
Tgm3
Name: transglutaminase 3, E polypeptide
Synonyms: TG E, we
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21818
Homologene: 20690
Cfap70
Name: cilia and flagella associated protein 70
Synonyms: 5330402L21Rik, Ttc18
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 76670
Homologene: 17048
Garre1
Name: granule associated Rac and RHOG effector 1
Synonyms: 4931406P16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233103
Homologene: 8795
Pcdhb10
Name: protocadherin beta 10
Synonyms: PcdhbJ, Pcdhb5D
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93881
HGNC: HGNC:8690
Homologene: 88834
Slc13a5
Name: solute carrier family 13 (sodium-dependent citrate transporter), member 5
Synonyms: NaC2/NaCT, Nact, Indy, mINDY
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237831
Homologene: 21941
Plek
Name: pleckstrin
Synonyms: 2010300B13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56193
HGNC: HGNC:9070
Homologene: 2000
Spock3
Name: sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3
Synonyms: testican 3, 2900045C01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72902
Homologene: 9662
Ap3b2
Name: adaptor-related protein complex 3, beta 2 subunit
Synonyms: Naptb, beta3B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11775
HGNC: HGNC:567
Homologene: 55837
Mmp3
Name: matrix metallopeptidase 3
Synonyms: stromelysin-1, stromelysin 1, progelatinase, Stmy1, STR-1, Str1, SLN1, SLN-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17392
VEGA: 9
HGNC: HGNC:7173
Homologene: 20545
Ankrd50
Name: ankyrin repeat domain 50
Synonyms: E430012K20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99696
Homologene: 129859
Or5k3
Name: olfactory receptor family 5 subfamily K member 3
Synonyms: Olfr195, MOR184-5, GA_x54KRFPKG5P-55369823-55370749
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 259000
Homologene: 128109
Erich6
Name: glutamate rich 6
Synonyms: Fam194a, 4932431H17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 545527
Homologene: 65043
Vmn2r94
Name: vomeronasal 2, receptor 94
Synonyms: EG665227
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665227
Homologene: 129751
Il18rap
Name: interleukin 18 receptor accessory protein
Synonyms: AcPL accessory protein-like)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16174
HGNC: HGNC:5989
Homologene: 2859
Adam22
Name: a disintegrin and metallopeptidase domain 22
Synonyms: MDC2, 2900022I03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11496
HGNC: HGNC:201
Homologene: 37898
Itgav
Name: integrin alpha V
Synonyms: vitronectin receptor alpha polypeptide (VNRA), 1110004F14Rik, alphav-integrin, 2610028E01Rik, CD51, D430040G12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16410
HGNC: HGNC:6150
Homologene: 20510
Asb2
Name: ankyrin repeat and SOCS box-containing 2
Synonyms: 1110008E15Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 65256
Homologene: 69202
Unc5c
Name: unc-5 netrin receptor C
Synonyms: B130051O18Rik, Unc5h3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22253
Homologene: 2765
Oxa1l
Name: oxidase assembly 1-like
Synonyms: 1810020M02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 69089
HGNC: HGNC:8526
Homologene: 31281
Ercc4
Name: excision repair cross-complementing rodent repair deficiency, complementation group 4
Synonyms: Xpf
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 50505
HGNC: HGNC:3436
Homologene: 3836
Smg8
Name: SMG8 nonsense mediated mRNA decay factor
Synonyms: smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans), 1200011M11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74133
Homologene: 32393
Tmc4
Name: transmembrane channel-like gene family 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 353499
Homologene: 16971
Irag2
Name: inositol 1,4,5-triphosphate receptor associated 2
Synonyms: D6Int5, Jaw1, Lrmp, D6Int7, D6Int8, D6Int4, D6Int3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16970
HGNC: HGNC:6690
Homologene: 4483
Klf11
Name: Kruppel-like transcription factor 11
Synonyms: Tieg2b, Tieg2, Tieg3, D12Ertd427e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 194655
Homologene: 2668
Skint8
Name: selection and upkeep of intraepithelial T cells 8
Synonyms: OTTMUSG00000009475
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 639774
Homologene: 106613
Ehbp1l1
Name: EH domain binding protein 1-like 1
Synonyms: G430002G23Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 114601
VEGA: 19
Homologene: 136059
Tmtc4
Name: transmembrane and tetratricopeptide repeat containing 4
Synonyms: 5730419O14Rik, 4930403J22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70551
Homologene: 32796
Krtap15-1
Name: keratin associated protein 15-1
Synonyms: Krtap15, Pmg-2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 26560
Homologene: 8439
Sgce
Name: sarcoglycan, epsilon
Synonyms: e-SG
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20392
Homologene: 31205
Ttll13
Name: tubulin tyrosine ligase-like family, member 13
Synonyms: 1700111A04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269954
Homologene: 136186
Or4b1b
Name: olfactory receptor family 4 subfamily B member 1B
Synonyms: Olfr1272, GA_x6K02T2Q125-51636504-51635578, MOR227-3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258982
HGNC: HGNC:8290
Homologene: 133649
Adamts17
Name: ADAM metallopeptidase with thrombospondin type 1 motif 17
Synonyms: AU023434
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233332
Homologene: 16373
Gm4553
Name: predicted gene 4553
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043617
Tent5a
Name: terminal nucleotidyltransferase 5A
Synonyms: BAP014, D930050G01Rik, Fam46a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 212943
Homologene: 23032
Il18r1
Name: interleukin 18 receptor 1
Synonyms: Il18ralpha, Il1rrp
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16182
HGNC: HGNC:5988
Homologene: 2861
Pheta1
Name: PH domain containing endocytic trafficking adaptor 1
Synonyms: Fam109a, Ses1, A230106M15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231717
Homologene: 16966
Pigw
Name: phosphatidylinositol glycan anchor biosynthesis, class W
Synonyms: Gwt1, 2610044A17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70325
Homologene: 6243
Or5p64
Name: olfactory receptor family 5 subfamily P member 64
Synonyms: GA_x6K02T2PBJ9-10586187-10585243, Olfr488, MOR204-15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258727
Homologene: 110483
R3hdml
Name: R3H domain containing-like
Synonyms: OTTMUSG00000001070
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100043899
Homologene: 45608
Septin12
Name: septin 12
Synonyms: 4933413B09Rik, Sept12, 1700028G04Rik, Septin12
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71089
VEGA: 16
Homologene: 69435
Unc93a
Name: unc-93 homolog A
Synonyms: Unc93l
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381058
Homologene: 10356
Alg5
Name: ALG5 dolichyl-phosphate beta-glucosyltransferase
Synonyms: 2600005J22Rik, 1500026A19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66248
Homologene: 7060
H1f4
Name: H1.4 linker histone, cluster member
Synonyms: H1s-4, Hist1h1e, H1-4, H1var2, H1e, H1f4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 50709
HGNC: HGNC:4718
Homologene: 137314
Noc2l
Name: NOC2 like nucleolar associated transcriptional repressor
Synonyms: NIR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 57741
VEGA: 4
Homologene: 6980
Trav14-3
Name: T cell receptor alpha variable 14-3
Synonyms: Gm13933
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 547330
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 16,460,329 bp
  • A to T, chromosome 1 at 40,474,832 bp
  • A to G, chromosome 1 at 40,525,376 bp
  • T to A, chromosome 1 at 121,510,428 bp
  • A to G, chromosome 2 at 31,604,612 bp
  • A to G, chromosome 2 at 49,279,743 bp
  • G to T, chromosome 2 at 83,794,983 bp
  • A to T, chromosome 2 at 90,282,404 bp
  • G to A, chromosome 2 at 130,048,291 bp
  • G to A, chromosome 2 at 163,502,447 bp
  • T to A, chromosome 2 at 181,995,820 bp
  • T to C, chromosome 3 at 38,483,183 bp
  • G to T, chromosome 3 at 54,749,331 bp
  • T to C, chromosome 3 at 58,636,884 bp
  • T to A, chromosome 3 at 141,789,942 bp
  • A to G, chromosome 4 at 63,972,722 bp
  • T to C, chromosome 4 at 111,939,520 bp
  • T to A, chromosome 4 at 156,239,216 bp
  • A to T, chromosome 5 at 3,618,875 bp
  • G to A, chromosome 5 at 8,090,202 bp
  • G to A, chromosome 5 at 62,649,724 bp
  • A to G, chromosome 5 at 92,173,992 bp
  • A to T, chromosome 5 at 121,853,273 bp
  • G to A, chromosome 6 at 4,691,615 bp
  • A to G, chromosome 6 at 124,826,318 bp
  • G to A, chromosome 6 at 145,158,698 bp
  • A to G, chromosome 7 at 3,669,919 bp
  • A to G, chromosome 7 at 34,263,647 bp
  • C to T, chromosome 7 at 66,840,556 bp
  • A to C, chromosome 7 at 80,254,163 bp
  • T to C, chromosome 7 at 81,461,028 bp
  • G to T, chromosome 7 at 108,255,218 bp
  • ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC to ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC, chromosome 7 at 142,165,420 bp
  • G to T, chromosome 8 at 63,113,556 bp
  • A to G, chromosome 9 at 7,446,937 bp
  • T to A, chromosome 9 at 14,575,219 bp
  • A to T, chromosome 9 at 45,943,690 bp
  • G to C, chromosome 9 at 85,324,617 bp
  • T to A, chromosome 10 at 88,762,935 bp
  • A to G, chromosome 10 at 123,013,946 bp
  • T to C, chromosome 11 at 16,994,739 bp
  • A to T, chromosome 11 at 72,245,127 bp
  • A to G, chromosome 11 at 74,665,704 bp
  • T to C, chromosome 11 at 84,877,240 bp
  • T to G, chromosome 11 at 87,085,565 bp
  • T to C, chromosome 12 at 24,655,519 bp
  • A to T, chromosome 12 at 103,333,357 bp
  • A to G, chromosome 13 at 23,622,367 bp
  • T to C, chromosome 13 at 49,378,308 bp
  • G to A, chromosome 13 at 73,642,376 bp
  • A to G, chromosome 13 at 92,286,004 bp
  • T to A, chromosome 14 at 20,400,434 bp
  • A to T, chromosome 14 at 53,763,494 bp
  • A to T, chromosome 14 at 54,360,855 bp
  • G to A, chromosome 14 at 122,978,181 bp
  • T to C, chromosome 15 at 12,592,243 bp
  • T to A, chromosome 15 at 78,525,006 bp
  • T to C, chromosome 16 at 4,991,735 bp
  • T to C, chromosome 16 at 11,222,657 bp
  • T to C, chromosome 16 at 13,122,113 bp
  • A to G, chromosome 16 at 17,405,632 bp
  • G to T, chromosome 16 at 17,671,643 bp
  • T to G, chromosome 16 at 59,149,321 bp
  • T to C, chromosome 16 at 88,829,305 bp
  • A to G, chromosome 17 at 13,116,284 bp
  • A to T, chromosome 17 at 15,742,274 bp
  • T to A, chromosome 17 at 18,243,620 bp
  • C to T, chromosome 17 at 24,901,718 bp
  • C to T, chromosome 17 at 37,069,413 bp
  • A to T, chromosome 18 at 37,413,026 bp
  • T to C, chromosome 19 at 5,720,702 bp
  • T to A, chromosome 19 at 6,314,504 bp
  • C to T, chromosome 19 at 42,583,540 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7317 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045369-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.