MMRRC:045451-MU

A to G, chromosome 1 at 4,347,998 bp
A to T, chromosome 1 at 38,074,407 bp
A to T, chromosome 1 at 58,666,864 bp
C to T, chromosome 1 at 111,861,573 bp
A to G, chromosome 1 at 116,442,295 bp
A to G, chromosome 1 at 128,153,392 bp
A to T, chromosome 1 at 140,086,521 bp
T to A, chromosome 2 at 75,868,313 bp
T to C, chromosome 2 at 85,984,343 bp
A to G, chromosome 2 at 90,037,812 bp
A to G, chromosome 2 at 155,969,307 bp
T to C, chromosome 2 at 180,192,958 bp
A to G, chromosome 3 at 86,104,228 bp
G to A, chromosome 3 at 96,636,678 bp
A to G, chromosome 3 at 138,290,551 bp
A to G, chromosome 3 at 142,810,727 bp
C to T, chromosome 4 at 28,871,937 bp
C to T, chromosome 4 at 139,452,691 bp
G to A, chromosome 4 at 139,779,749 bp
G to A, chromosome 5 at 72,605,358 bp
T to C, chromosome 5 at 73,608,381 bp
T to A, chromosome 5 at 76,856,602 bp
T to A, chromosome 5 at 76,919,864 bp
C to T, chromosome 6 at 47,963,919 bp
C to G, chromosome 7 at 19,370,156 bp
A to G, chromosome 7 at 25,296,066 bp
A to T, chromosome 7 at 25,805,973 bp
T to A, chromosome 7 at 64,268,801 bp
A to G, chromosome 7 at 81,535,180 bp
G to T, chromosome 7 at 98,498,879 bp
A to G, chromosome 7 at 141,064,475 bp
GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG to GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG, chromosome 7 at 142,240,434 bp
A to T, chromosome 8 at 25,033,697 bp
A to G, chromosome 10 at 39,158,265 bp
A to G, chromosome 10 at 71,336,360 bp
C to T, chromosome 10 at 78,182,480 bp
A to G, chromosome 10 at 81,580,318 bp
A to T, chromosome 10 at 88,795,443 bp
A to T, chromosome 10 at 127,993,623 bp
A to G, chromosome 10 at 128,833,378 bp
A to G, chromosome 11 at 17,232,712 bp
A to G, chromosome 11 at 43,247,501 bp
T to C, chromosome 11 at 69,908,582 bp
G to A, chromosome 11 at 78,950,090 bp
T to C, chromosome 11 at 118,115,196 bp
T to C, chromosome 12 at 58,966,999 bp
T to A, chromosome 12 at 117,987,442 bp
T to A, chromosome 13 at 17,644,814 bp
A to G, chromosome 13 at 23,751,350 bp
T to G, chromosome 13 at 41,008,895 bp
C to A, chromosome 13 at 92,438,287 bp
C to T, chromosome 15 at 45,109,242 bp
A to G, chromosome 16 at 3,839,302 bp
T to A, chromosome 16 at 36,898,546 bp
G to T, chromosome 17 at 25,373,210 bp
T to A, chromosome 18 at 50,155,185 bp
A to G, chromosome 18 at 61,989,506 bp
A to T, chromosome 18 at 90,591,100 bp
T to A, chromosome 19 at 37,420,341 bp

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Suggested Control Mice

Wild-type littermates or C57BL/6J mice

MMRRC Genetic QC

MMRRC Genetic QC Summary

The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R7367 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Request Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
045451-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Request Information Expand All