Strain Name:
C57BL/6J-MtgxR7368Btlr/Mmmh
Stock Number:
045452-MU
Citation ID:
RRID:MMRRC_045452-MU
Other Names:
R7368 (G1)
Major Collection:

Strain Information

Ednrb
Name: endothelin receptor type B
Synonyms: Sox10m1, ETR-b, ETb
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13618
VEGA: 14
HGNC: HGNC:3180
Homologene: 89
Kitl
Name: kit ligand
Synonyms: stem cell factor, Sl, grizzle-belly, Steel factor, SLF, SF, Mgf, Gb, SCF, Kitlg, blz, Steel
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17311
HGNC: HGNC:6343
Homologene: 692
Ptch1
Name: patched 1
Synonyms: wig, Ptc, A230106A15Rik, Ptc1, Patched 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19206
HGNC: HGNC:9585
Homologene: 223
Fkbp11
Name: FK506 binding protein 11
Synonyms: 1110002O23Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66120
VEGA: 15
Homologene: 9581
Epha7
Name: Eph receptor A7
Synonyms: MDK1, Hek11, Mdk1, Cek11, Ebk, Ehk3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Cyrib
Name: CYFIP related Rac1 interactor B
Synonyms: Fam49b, 0910001A06Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223601
VEGA: 15
Homologene: 9599
Hdac5
Name: histone deacetylase 5
Synonyms: mHDA1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15184
Homologene: 3995
Pef1
Name: penta-EF hand domain containing 1
Synonyms: 2600002E23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67898
Homologene: 56569
Ptpn3
Name: protein tyrosine phosphatase, non-receptor type 3
Synonyms: 9530011I20Rik, PTPCL, PTP-H1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 545622
HGNC: HGNC:9655
Homologene: 74451
Lrp5
Name: low density lipoprotein receptor-related protein 5
Synonyms: LRP7, LR3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16973
Homologene: 1746
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Zfp638
Name: zinc finger protein 638
Synonyms: Np220, Zfml
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18139
Homologene: 7447
Taf3
Name: TATA-box binding protein associated factor 3
Synonyms: 4933439M23Rik, mTAFII140
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209361
Homologene: 35415
Usp15
Name: ubiquitin specific peptidase 15
Synonyms: 4921514G19Rik, Gcap18, E430033I05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14479
VEGA: 10
Homologene: 101542
Pcnt
Name: pericentrin (kendrin)
Synonyms: m275Asp, Pcnt2, m239Asp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18541
VEGA: 10
Larp1
Name: La ribonucleoprotein 1, translational regulator
Synonyms: 1810024J12Rik, 3110040D16Rik, Larp
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73158
Homologene: 9089
Polr3a
Name: polymerase (RNA) III (DNA directed) polypeptide A
Synonyms: RPC1, RPC155, 9330175N20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218832
VEGA: 14
Homologene: 5124
Lrp6
Name: low density lipoprotein receptor-related protein 6
Synonyms: skam26Jus, ska26, skax26, Cd
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16974
HGNC: HGNC:6698
Homologene: 1747
Nek1
Name: NIMA (never in mitosis gene a)-related expressed kinase 1
Synonyms: kat, kidney, anemia and testis, D8Ertd790e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18004
HGNC: HGNC:7744
Homologene: 14376
Ddit3
Name: DNA-damage inducible transcript 3
Synonyms: CHOP10, gadd153, CHOP-10, chop, C/EBP homoologous protein 10
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13198
HGNC: HGNC:2726
Homologene: 3012
Gpbp1l1
Name: GC-rich promoter binding protein 1-like 1
Synonyms: 5330440M15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77110
Homologene: 84840
Myt1
Name: myelin transcription factor 1
Synonyms: NZF-2a, NZF-2b, Nztf2, Nzf2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17932
HGNC: HGNC:7622
Homologene: 3332
Frem1
Name: Fras1 related extracellular matrix protein 1
Synonyms: heb, eyem02Jus, eyes2, QBRICK, crf11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329872
Homologene: 27049
Adcy1
Name: adenylate cyclase 1
Synonyms: I-AC, D11Bwg1392e, AC1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432530
HGNC: HGNC:232
Homologene: 41419
Mmp27
Name: matrix metallopeptidase 27
Synonyms: LOC234911
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 234911
Homologene: 23345
Ms4a6d
Name: membrane-spanning 4-domains, subfamily A, member 6D
Synonyms: Ms4a11
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68774
Homologene: 130755
Pwp2
Name: PWP2 periodic tryptophan protein homolog (yeast)
Synonyms: Pwp2h, Pwp2, 6530411D08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 110816
VEGA: 10
HGNC: HGNC:9711
Homologene: 3702
Nol8
Name: nucleolar protein 8
Synonyms: 4921532D18Rik, 5730412B09Rik, D13Ertd548e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 70930
VEGA: 13
Homologene: 41210
Edc4
Name: enhancer of mRNA decapping 4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234699
Homologene: 40937
Slc35f5
Name: solute carrier family 35, member F5
Synonyms: 1300003P13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74150
Homologene: 5745
Stra6
Name: stimulated by retinoic acid gene 6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20897
Homologene: 7554
St6galnac2
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
Synonyms: ST6GalNAc II, Siat7b, Siat7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20446
Homologene: 4714
Myo15a
Name: myosin XVA
Synonyms: Myo15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17910
HGNC: HGNC:7594
Homologene: 56504
Arhgef28
Name: Rho guanine nucleotide exchange factor 28
Synonyms: D13Bwg1089e, Rho specific exchange factor, 9230110L08Rik, RIP2, Rgnef, p190RhoGEF, RhoGEF
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110596
VEGA: 13
Homologene: 8078
Catsper1
Name: cation channel, sperm associated 1
Synonyms: KSper
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225865
VEGA: 19
Homologene: 14207
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Zfp458
Name: zinc finger protein 458
Synonyms: Rslcan-7
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238690
VEGA: 13
Homologene: 128170
Nynrin
Name: NYN domain and retroviral integrase containing
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 277154
VEGA: 14
Homologene: 19483
Dscam
Name: DS cell adhesion molecule
Synonyms: Down syndrome cell adhesion molecule, 4932410A21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13508
HGNC: HGNC:3039
Homologene: 74393
Nlrc5
Name: NLR family, CARD domain containing 5
Synonyms: AI451557
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 434341
Homologene: 88935
Gm11437
Name: predicted gene 11437
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 628813
Homologene: 82346
Sppl2c
Name: signal peptide peptidase 2C
Synonyms: 4933407P14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237958
Homologene: 18491
Abcd4
Name: ATP-binding cassette, sub-family D member 4
Synonyms: P69r, Pxmp1l
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19300
VEGA: 12
HGNC: HGNC:68
Homologene: 3703
Tbx18
Name: T-box18
Synonyms: 2810012F10Rik, 2810404D13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76365
Homologene: 11384
Sh2b1
Name: SH2B adaptor protein 1
Synonyms: Sh2bpsm1, Irip, SH2-B, SH2-Bb
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20399
Homologene: 32122
Vmn2r91
Name: vomeronasal 2, receptor 91
Synonyms: EG665210
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665210
Homologene: 115024
Unc45b
Name: unc-45 myosin chaperone B
Synonyms: Cmya4, D230041A13Rik, UNC45
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217012
Homologene: 14666
Or8h9
Name: olfactory receptor family 8 subfamily H member 9
Synonyms: Olfr1099, GA_x6K02T2Q125-48446067-48445129, MOR206-3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258764
Homologene: 107003
Osbpl3
Name: oxysterol binding protein-like 3
Synonyms: OSBP3, 6720421I08Rik, ORP3, 1200014M06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71720
Homologene: 49422
Hivep3
Name: human immunodeficiency virus type I enhancer binding protein 3
Synonyms: Shn3, E030045D18Rik, Krc, 2900056N03Rik, Schnurri-3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16656
Homologene: 7803
Gabrg2
Name: gamma-aminobutyric acid type A receptor, subunit gamma 2
Synonyms: Gabrg-2, GABAA-R, gamma2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14406
HGNC: HGNC:4087
Homologene: 22443
Krt1
Name: keratin 1
Synonyms: Krt-2.1, Krt2-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Ehd3
Name: EH-domain containing 3
Synonyms: Ehd2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57440
HGNC: HGNC:3244
Homologene: 81837
Carmil2
Name: capping protein regulator and myosin 1 linker 2
Synonyms: Rltpr, D130029J02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234695
Homologene: 128439
Tgoln1
Name: trans-golgi network protein
Synonyms: TGN38A, TGN38, Ttgn1, D6Ertd384e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22134
Homologene: 137224
Cpa2
Name: carboxypeptidase A2, pancreatic
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232680
HGNC: HGNC:2297
Homologene: 37541
Phf11a
Name: PHD finger protein 11A
Synonyms: Phf11, 4933417L10Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219131
Homologene: 87807
Apol9b
Name: apolipoprotein L 9b
Synonyms: 2310016F22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71898
VEGA: 15
Homologene: 77567
B020004C17Rik
Name: RIKEN cDNA B020004C17 gene
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 432860
VEGA: 14
Homologene: 128423
Scgb1b12
Name: secretoglobin, family 1B, member 12
Synonyms: Abpa12, Gm9140
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 668381
Homologene: 114479
Gm9195
Name: predicted gene 9195
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 675947
Homologene: 139067
Gm8947
Name: predicted gene 8947
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 668050
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 125,584,519 bp
  • C to A, chromosome 1 at 151,193,096 bp
  • T to C, chromosome 2 at 9,916,377 bp
  • A to G, chromosome 2 at 86,959,258 bp
  • A to G, chromosome 2 at 181,782,591 bp
  • C to T, chromosome 4 at 28,871,937 bp
  • T to C, chromosome 4 at 57,221,993 bp
  • T to A, chromosome 4 at 82,966,144 bp
  • T to C, chromosome 4 at 116,573,458 bp
  • CGG to CG, chromosome 4 at 120,097,911 bp
  • T to A, chromosome 4 at 130,127,385 bp
  • T to A, chromosome 6 at 30,551,990 bp
  • A to T, chromosome 6 at 50,348,098 bp
  • G to C, chromosome 6 at 72,616,278 bp
  • A to G, chromosome 6 at 83,929,455 bp
  • G to T, chromosome 6 at 134,450,818 bp
  • T to C, chromosome 7 at 32,334,567 bp
  • T to C, chromosome 7 at 120,029,016 bp
  • A to T, chromosome 7 at 126,468,513 bp
  • T to A, chromosome 8 at 61,089,707 bp
  • C to T, chromosome 8 at 94,476,393 bp
  • C to T, chromosome 8 at 105,690,835 bp
  • TAGTAGCAGCAGCAGTAGCAGCAGCAG to TAGTAGCAGCAGCAG, chromosome 8 at 105,888,405 bp
  • G to A, chromosome 9 at 7,577,317 bp
  • G to A, chromosome 9 at 58,151,260 bp
  • C to A, chromosome 9 at 67,914,073 bp
  • C to A, chromosome 9 at 87,730,697 bp
  • T to C, chromosome 10 at 76,400,001 bp
  • C to T, chromosome 10 at 78,182,480 bp
  • A to T, chromosome 10 at 100,016,081 bp
  • T to C, chromosome 10 at 123,196,893 bp
  • G to A, chromosome 10 at 127,295,907 bp
  • G to A, chromosome 11 at 7,144,765 bp
  • A to C, chromosome 11 at 41,976,563 bp
  • C to A, chromosome 11 at 58,048,078 bp
  • G to T, chromosome 11 at 60,490,915 bp
  • C to T, chromosome 11 at 82,942,495 bp
  • T to A, chromosome 11 at 84,167,472 bp
  • A to T, chromosome 11 at 102,197,381 bp
  • A to G, chromosome 11 at 104,187,604 bp
  • T to C, chromosome 11 at 116,679,979 bp
  • A to T, chromosome 12 at 84,612,865 bp
  • T to C, chromosome 13 at 49,661,219 bp
  • C to T, chromosome 13 at 63,511,984 bp
  • T to A, chromosome 13 at 67,257,236 bp
  • C to A, chromosome 13 at 97,996,862 bp
  • A to T, chromosome 14 at 24,467,076 bp
  • T to A, chromosome 14 at 55,870,511 bp
  • C to T, chromosome 14 at 57,017,316 bp
  • T to C, chromosome 14 at 59,280,725 bp
  • A to G, chromosome 14 at 72,480,056 bp
  • T to A, chromosome 14 at 103,820,017 bp
  • A to T, chromosome 15 at 63,938,658 bp
  • T to C, chromosome 15 at 77,735,934 bp
  • T to C, chromosome 15 at 98,724,426 bp
  • T to C, chromosome 15 at 101,846,872 bp
  • A to G, chromosome 16 at 96,643,931 bp
  • A to G, chromosome 17 at 18,136,278 bp
  • A to G, chromosome 17 at 73,827,462 bp
  • A to G, chromosome 19 at 3,620,085 bp
  • A to T, chromosome 19 at 5,336,663 bp
  • G to A, chromosome 19 at 11,590,073 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7368 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045452-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.