Strain Name:
C57BL/6J-MtgxR8045Btlr/Mmmh
Stock Number:
067482-MU
Citation ID:
RRID:MMRRC_067482-MU
Other Names:
R8045 (G1)
Major Collection:

Strain Information

Igf2bp2
Name: insulin-like growth factor 2 mRNA binding protein 2
Synonyms: C330012H03Rik, IMP-2, IMP2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 319765
Homologene: 4774
Topors
Name: topoisomerase I binding, arginine/serine-rich
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 106021
Homologene: 4237
Wdr20
Name: WD repeat domain 20
Synonyms: 2310040A13Rik, Wdr20a
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 69641
Homologene: 32684
Lta4h
Name: leukotriene A4 hydrolase
Synonyms: LTA4 hydrodase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16993
VEGA: 10
HGNC: HGNC:6710
Homologene: 6820
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D15F32S1h, D7H15F37S1, jdf2, rjs, D7H15F32S1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Rbbp4
Name: retinoblastoma binding protein 4, chromatin remodeling factor
Synonyms: CAF-1 p48 subunit, RBAP48
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19646
HGNC: HGNC:9887
Homologene: 21153
Mllt3
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 3
Synonyms: 2210011H10Rik, D4Ertd321e, 3830408D16Rik, Af9, 2610012I03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70122
HGNC: HGNC:7136
Homologene: 37933
Clint1
Name: clathrin interactor 1
Synonyms: Epn4, C530049I24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216705
Homologene: 133740
Ncam1
Name: neural cell adhesion molecule 1
Synonyms: NCAM-140, CD56, NCAM-1, NCAM-180, NCAM-120, E-NCAM, NCAM
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17967
HGNC: HGNC:7656
Homologene: 40754
Casz1
Name: castor zinc finger 1
Synonyms: 2410019P08Rik, Cst, D4Ertd432e, castor
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69743
Homologene: 9824
Crnkl1
Name: crooked neck pre-mRNA splicing factor 1
Synonyms: 5730590A01Rik, 1200013P10Rik, crn
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66877
Homologene: 6462
Amotl2
Name: angiomotin-like 2
Synonyms: MASCOT, Lccp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56332
Homologene: 9420
Mamstr
Name: MEF2 activating motif and SAP domain containing transcriptional regulator
Synonyms: 2810022D01Rik, 5430432N15Rik, MASTR
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74490
Homologene: 77700
Clcn1
Name: chloride channel, voltage-sensitive 1
Synonyms: nmf355, Clc1, SMCC1, NMF355, Clc-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12723
HGNC: HGNC:2019
Homologene: 63
Ccdc175
Name: coiled-coil domain containing 175
Synonyms: 4930403N07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73936
VEGA: 12
Homologene: 79144
Myh7b
Name: myosin, heavy chain 7B, cardiac muscle, beta
Synonyms: Myh14
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668940
Homologene: 66117
Arhgap29
Name: Rho GTPase activating protein 29
Synonyms: Parg1, B130017I01Rik, 6720461J18Rik, C76601
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214137
Homologene: 3539
Zfp652
Name: zinc finger protein 652
Synonyms: 9530033F24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268469
Homologene: 54768
Taar2
Name: trace amine-associated receptor 2
Synonyms: Gpr58
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 209512
HGNC: HGNC:4514
Homologene: 110760
Ccdc148
Name: coiled-coil domain containing 148
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227933
Homologene: 16353
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Ccdc192
Name: coiled-coil domain containing 192
Synonyms: 1700011I03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 75444
Homologene: 133296
Cebpz
Name: CCAAT/enhancer binding protein zeta
Synonyms: Cbf, Cebpa-rs1, CBF2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12607
VEGA: 17
Homologene: 4210
Dao
Name: D-amino acid oxidase
Synonyms: Dao-1, DAO, Dao1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13142
HGNC: HGNC:2671
Homologene: 37553
Cfhr4
Name: complement factor H-related 4
Synonyms: Gm4788
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214403
HGNC: HGNC:4883
Gm15446
Name: predicted gene 15446
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100642166
Vmn1r121
Name: vomeronasal 1 receptor 121
Synonyms: Gm8533
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667240
Homologene: 104166
Pde11a
Name: phosphodiesterase 11A
Synonyms: A630086N24Rik, 6330414F14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241489
HGNC: HGNC:8773
Homologene: 56763
Rbm20
Name: RNA binding motif protein 20
Synonyms: 2010003H22Rik, 1110018J23Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73713
Homologene: 28386
Zfp512b
Name: zinc finger protein 512B
Synonyms: LOC269401, Znf512b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269401
Homologene: 69314
Ccdc142
Name: coiled-coil domain containing 142
Synonyms: A230058J24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243510
Homologene: 27813
Prpf38b
Name: PRP38 pre-mRNA processing factor 38 (yeast) domain containing B
Synonyms: 1110021E09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66921
Homologene: 9986
Or5h25
Name: olfactory receptor family 5 subfamily H member 25
Synonyms: MOR183-7P, Olfr1540-ps1, GA_x54KRFPKG5P-55338697-55337768, MOR113-7P, MOR113-7P, Olfr193
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 257972
Homologene: 128162
Slc27a3
Name: solute carrier family 27 (fatty acid transporter), member 3
Synonyms: fatty acid transport protein 3, Acsvl3, FATP3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26568
Homologene: 11529
Sema6c
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
Synonyms: Semay, Sema Y
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20360
Homologene: 7931
Clpsl2
Name: colipase-like 2
Synonyms: LOC328788, Gm749
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328788
Homologene: 86835
Anks1b
Name: ankyrin repeat and sterile alpha motif domain containing 1B
Synonyms: E530015N03Rik, Gm10937, AIDA-1b, LOC380650, C030032C09Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77531
Homologene: 51570
Disp1
Name: dispatched RND transporter family member 1
Synonyms: 1190008H24Rik, DispA
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68897
Homologene: 14133
Or56a41
Name: olfactory receptor family 56 subfamily A member 41, pseudogene 1
Synonyms: GA_x6K02T2PBJ9-7720330-7719479, MOR40-10P, Olfr680
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257981
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 139,733,505 bp
  • T to C, chromosome 1 at 183,089,230 bp
  • A to G, chromosome 2 at 59,002,071 bp
  • G to A, chromosome 2 at 76,022,728 bp
  • G to A, chromosome 2 at 145,932,931 bp
  • A to T, chromosome 2 at 155,613,181 bp
  • AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG to AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG, chromosome 2 at 180,595,057 bp
  • A to G, chromosome 2 at 181,584,824 bp
  • A to G, chromosome 3 at 90,387,142 bp
  • C to T, chromosome 3 at 95,173,224 bp
  • T to C, chromosome 3 at 108,904,034 bp
  • C to A, chromosome 3 at 122,007,562 bp
  • A to G, chromosome 4 at 40,261,988 bp
  • A to G, chromosome 4 at 87,841,113 bp
  • A to G, chromosome 4 at 129,317,900 bp
  • A to G, chromosome 4 at 148,932,779 bp
  • A to G, chromosome 5 at 109,940,528 bp
  • AGG to AG, chromosome 5 at 114,015,209 bp
  • T to C, chromosome 6 at 42,290,694 bp
  • T to C, chromosome 6 at 83,103,426 bp
  • T to G, chromosome 7 at 21,097,904 bp
  • T to A, chromosome 7 at 45,644,403 bp
  • T to C, chromosome 7 at 56,184,900 bp
  • A to T, chromosome 7 at 105,090,983 bp
  • T to C, chromosome 9 at 49,507,436 bp
  • C to T, chromosome 9 at 102,723,769 bp
  • T to C, chromosome 10 at 23,941,488 bp
  • A to G, chromosome 10 at 90,680,860 bp
  • A to G, chromosome 10 at 93,469,106 bp
  • T to A, chromosome 11 at 45,890,739 bp
  • T to C, chromosome 11 at 95,749,657 bp
  • C to T, chromosome 12 at 72,155,902 bp
  • T to A, chromosome 12 at 110,793,319 bp
  • T to A, chromosome 16 at 22,083,978 bp
  • A to T, chromosome 16 at 59,110,039 bp
  • G to A, chromosome 17 at 28,550,728 bp
  • A to G, chromosome 17 at 78,932,156 bp
  • A to T, chromosome 18 at 57,730,919 bp
  • C to A, chromosome 19 at 53,817,971 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8045 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067482-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.