Strain Name:
C57BL/6J-MtgxR8099Btlr/Mmmh
Stock Number:
067531-MU
Citation ID:
RRID:MMRRC_067531-MU
Other Names:
R8099 (G1)
Major Collection:

Strain Information

Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Aclp7, Acf7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Mkrn1
Name: makorin, ring finger protein, 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54484
HGNC: HGNC:7112
Homologene: 32175
Prrc2b
Name: proline-rich coiled-coil 2B
Synonyms: 5830434P21Rik, Bat2l
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227723
Homologene: 106649
Sipa1l1
Name: signal-induced proliferation-associated 1 like 1
Synonyms: Spar, 4931426N11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217692
VEGA: 12
Homologene: 9189
Foxp1
Name: forkhead box P1
Synonyms: 4932443N09Rik, 3110052D19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108655
HGNC: HGNC:3823
Homologene: 13092
Ptpn3
Name: protein tyrosine phosphatase, non-receptor type 3
Synonyms: PTP-H1, 9530011I20Rik, PTPCL
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 545622
HGNC: HGNC:9655
Homologene: 74451
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: p53BP1, 53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Cpne3
Name: copine III
Synonyms: CPN3, PRO1071, 5430428M23Rik, 5730450C07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70568
HGNC: HGNC:2316
Homologene: 20839
Usp15
Name: ubiquitin specific peptidase 15
Synonyms: Gcap18, E430033I05Rik, 4921514G19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14479
VEGA: 10
Homologene: 101542
Epb41l3
Name: erythrocyte membrane protein band 4.1 like 3
Synonyms: NBL3, Epb4.1l3, 4.1B, DAL1P
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13823
HGNC: HGNC:3380
Homologene: 49308
Slc12a2
Name: solute carrier family 12, member 2
Synonyms: mBSC2, sy-ns, sodium/potassium/chloride cotransporters, Nkcc1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20496
VEGA: 18
Homologene: 20283
Tanc2
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms: 5730590C14Rik, 3526402J09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77097
Homologene: 64680
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: tbl, D130015N03Rik, 2810449H11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Sltm
Name: SAFB-like, transcription modulator
Synonyms: 5730455C01Rik, 5730555F13Rik, 9130215G10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66660
VEGA: 9
Homologene: 11696
Kctd17
Name: potassium channel tetramerisation domain containing 17
Synonyms: 2900008M13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72844
Homologene: 23468
Srsf1
Name: serine and arginine-rich splicing factor 1
Synonyms: 1110054N12Rik, 5730507C05Rik, 6330415C05Rik, Sfrs1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 110809
Homologene: 31411
Wnt2b
Name: wingless-type MMTV integration site family, member 2B
Synonyms: Wnt13
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22414
Homologene: 22526
Golga3
Name: golgin A3
Synonyms: Mea2, 5430416E01Rik, repro27, Mea-2, G1-499-14
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269682
HGNC: HGNC:4426
Homologene: 4308
Dgcr2
Name: DiGeorge syndrome critical region gene 2
Synonyms: DGS-C, Sez12, Lan, Idd, Dgcr2, Dgsc, 9930034O06Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13356
HGNC: HGNC:2845
Homologene: 31292
Muc2
Name: mucin 2
Synonyms: 2010015E03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17831
HGNC: HGNC:7512
Homologene: 136755
Ssh2
Name: slingshot protein phosphatase 2
Synonyms: SSH-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237860
Homologene: 14116
Stra6
Name: stimulated by retinoic acid gene 6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20897
Homologene: 7554
Ell3
Name: elongation factor RNA polymerase II-like 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269344
Homologene: 11859
Nr1h2
Name: nuclear receptor subfamily 1, group H, member 2
Synonyms: LXRbeta, RIP15, LXRB, Unr2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22260
HGNC: HGNC:7965
Homologene: 21397
Dnah1
Name: dynein, axonemal, heavy chain 1
Synonyms: MDHC7, Dnahc1, B230373P09Rik, E030034C22Rik, ferf1, G1-415-19
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110084
VEGA: 14
HGNC: HGNC:2940
Homologene: 67131
9930012K11Rik
Name: RIKEN cDNA 9930012K11 gene
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268759
Homologene: 19540
Cfap74
Name: cilia and flagella associated protein 74
Synonyms: 2010015L04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 544678
Homologene: 129584
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: Adgrc1, crash, Crsh, Scy
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Pkd1l3
Name: polycystic kidney disease 1 like 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244646
Homologene: 14627
Lama3
Name: laminin, alpha 3
Synonyms: nicein, 150kDa, [a]3B
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Plcb1
Name: phospholipase C, beta 1
Synonyms: 3110043I21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18795
Homologene: 22876
Vmn2r15
Name: vomeronasal 2, receptor 15
Synonyms: EG211223
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 211223
Homologene: 129606
Abcb9
Name: ATP-binding cassette, sub-family B member 9
Synonyms: TAPL
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56325
HGNC: HGNC:50
Homologene: 10491
Ssu2
Name: ssu-2 homolog
Synonyms: D630042P16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243612
Homologene: 136556
Ccdc110
Name: coiled-coil domain containing 110
Synonyms: LOC212392
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212392
Homologene: 17668
Abcc9
Name: ATP-binding cassette, sub-family C member 9
Synonyms: SUR2B, Sur2, SUR2A
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20928
HGNC: HGNC:60
Homologene: 56521
Pitpnm3
Name: PITPNM family member 3
Synonyms: A330068P14Rik, Ackr6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327958
Homologene: 66271
Vmn2r94
Name: vomeronasal 2, receptor 94
Synonyms: EG665227
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665227
Homologene: 129751
Ppm1d
Name: protein phosphatase 1D magnesium-dependent, delta isoform
Synonyms: Wip1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53892
HGNC: HGNC:9277
Homologene: 31185
Per3
Name: period circadian clock 3
Synonyms: mPer3, 2810049O06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18628
HGNC: HGNC:8847
Homologene: 7886
Atp11a
Name: ATPase, class VI, type 11A
Synonyms: Ih, 9130422H11Rik, LOC100045280, 4930558F19Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50770
Homologene: 75050
Chil3
Name: chitinase-like 3
Synonyms: Chi3l3, Ym1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12655
Homologene: 74931
Nipal4
Name: NIPA-like domain containing 4
Synonyms: 9530066K23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 214112
Homologene: 133769
Vmn2r8
Name: vomeronasal 2, receptor 8
Synonyms: EG627479
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 627479
Homologene: 129606
C1ra
Name: complement component 1, r subcomponent A
Synonyms: mC1rA
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50909
HGNC: HGNC:1246
Homologene: 1313
Ctsh
Name: cathepsin H
Synonyms: Cat H
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13036
HGNC: HGNC:2535
Homologene: 36159
H1f1
Name: H1.1 linker histone, cluster member
Synonyms: Hist1h1a, H1a, H1var3, H1.1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 80838
HGNC: HGNC:4715
Homologene: 135937
Cyp3a44
Name: cytochrome P450, family 3, subfamily a, polypeptide 44
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 337924
HGNC: HGNC:2638
Homologene: 133568
Or9m1
Name: olfactory receptor family 9 subfamily M member 1
Synonyms: MOR173-2, Olfr1154, GA_x6K02T2Q125-49403456-49402524
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258641
Homologene: 74192
Kti12
Name: KTI12 homolog, chromatin associated
Synonyms: 1110001A12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100087
Homologene: 6347
Sema4g
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 26456
Homologene: 22682
Entrep3
Name: endosomal transmembrane epsin interactor 3
Synonyms: 1110013L07Rik, Fam189b
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68521
HGNC: HGNC:1233
Homologene: 4805
Or11m3
Name: olfactory receptor family 11 subfamily M member 3
Synonyms: GA_x6K02T2NBG7-5241885-5241019, MOR122-1, Olfr279, GA_x6K02T04SN1-554-3, Olfr234
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 258502
Homologene: 74008
Rapgefl1
Name: Rap guanine nucleotide exchange factor (GEF)-like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268480
Homologene: 41126
Odam
Name: odontogenic, ameloblast asssociated
Synonyms: 2310011G06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69592
Homologene: 49511
Or6c35
Name: olfactory receptor family 6 subfamily C member 35
Synonyms: Olfr781, GA_x6K02T2PULF-11013616-11014551, MOR114-6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258723
Homologene: 37000
Ciart
Name: circadian associated repressor of transcription
Synonyms: LOC229599, Gm129
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229599
Homologene: 79670
Fbxo3
Name: F-box protein 3
Synonyms: 1200002G09Rik, 1700026K02Rik, Fba
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 57443
Homologene: 8133
Igkv4-53
Name: immunoglobulin kappa variable 4-53
Synonyms: LOC384516, LOC385259
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 546213
Gm29106
Name: predicted gene 29106
Type: Gene
Species: Mouse
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 118,198,791 bp
  • T to C, chromosome 2 at 32,208,674 bp
  • T to A, chromosome 2 at 87,903,508 bp
  • A to C, chromosome 2 at 104,054,935 bp
  • A to G, chromosome 2 at 121,199,749 bp
  • TCTCCTC to TCTC, chromosome 2 at 121,439,456 bp
  • T to C, chromosome 2 at 135,251,734 bp
  • T to C, chromosome 3 at 89,183,943 bp
  • G to A, chromosome 3 at 95,881,344 bp
  • A to T, chromosome 3 at 104,947,092 bp
  • T to G, chromosome 3 at 106,148,668 bp
  • A to G, chromosome 4 at 19,525,169 bp
  • A to T, chromosome 4 at 57,204,985 bp
  • G to T, chromosome 4 at 108,848,374 bp
  • A to T, chromosome 4 at 123,476,129 bp
  • A to T, chromosome 4 at 151,012,557 bp
  • A to G, chromosome 4 at 155,455,032 bp
  • T to C, chromosome 5 at 87,892,440 bp
  • A to T, chromosome 5 at 108,801,834 bp
  • A to T, chromosome 5 at 109,293,319 bp
  • T to A, chromosome 5 at 110,188,707 bp
  • A to G, chromosome 5 at 124,077,245 bp
  • T to C, chromosome 5 at 145,788,402 bp
  • T to C, chromosome 6 at 39,410,097 bp
  • A to T, chromosome 6 at 69,648,914 bp
  • C to T, chromosome 6 at 98,945,549 bp
  • T to C, chromosome 6 at 112,376,477 bp
  • G to A, chromosome 6 at 124,517,725 bp
  • A to T, chromosome 6 at 142,675,531 bp
  • T to C, chromosome 7 at 44,550,322 bp
  • A to T, chromosome 7 at 103,250,288 bp
  • T to A, chromosome 7 at 141,745,438 bp
  • T to G, chromosome 8 at 12,861,973 bp
  • T to A, chromosome 8 at 45,942,093 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to A, chromosome 9 at 58,152,494 bp
  • T to A, chromosome 9 at 66,372,140 bp
  • T to A, chromosome 9 at 70,586,078 bp
  • T to C, chromosome 9 at 90,064,247 bp
  • T to C, chromosome 10 at 123,146,921 bp
  • T to A, chromosome 10 at 129,333,127 bp
  • T to C, chromosome 11 at 46,162,021 bp
  • T to A, chromosome 11 at 72,070,318 bp
  • C to T, chromosome 11 at 77,454,929 bp
  • C to T, chromosome 11 at 85,339,666 bp
  • T to C, chromosome 11 at 88,049,256 bp
  • T to C, chromosome 11 at 98,847,383 bp
  • T to A, chromosome 11 at 105,864,007 bp
  • C to T, chromosome 12 at 82,433,826 bp
  • C to T, chromosome 13 at 23,763,849 bp
  • A to T, chromosome 14 at 31,302,364 bp
  • T to C, chromosome 14 at 70,157,520 bp
  • CAGCTGGAGGAGC to CAGC, chromosome 15 at 78,436,913 bp
  • A to G, chromosome 15 at 86,031,600 bp
  • A to G, chromosome 15 at 98,497,813 bp
  • A to T, chromosome 16 at 17,849,769 bp
  • T to C, chromosome 17 at 18,257,397 bp
  • T to A, chromosome 17 at 69,247,688 bp
  • T to A, chromosome 18 at 12,534,063 bp
  • T to C, chromosome 18 at 57,899,392 bp
  • T to C, chromosome 19 at 44,992,528 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8099 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067531-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.