Strain Name:
C57BL/6J-MtgxR8438Btlr/Mmmh
Stock Number:
067778-MU
Citation ID:
RRID:MMRRC_067778-MU
Other Names:
R8438 (G1)
Major Collection:

Strain Information

Itpk1
Name: inositol 1,3,4-triphosphate 5/6 kinase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217837
HGNC: HGNC:6177
Homologene: 8588
Aldh1l1
Name: aldehyde dehydrogenase 1 family, member L1
Synonyms: Fthfd, 1810048F20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107747
HGNC: HGNC:3978
Homologene: 122031
Dgat2
Name: diacylglycerol O-acyltransferase 2
Synonyms: 0610010B06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67800
Homologene: 23580
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Mef2c
Name: myocyte enhancer factor 2C
Synonyms: 9930028G15Rik, 5430401D19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17260
HGNC: HGNC:6996
Homologene: 31087
Thada
Name: thyroid adenoma associated
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240174
VEGA: 17
Homologene: 75175
Top3b
Name: topoisomerase (DNA) III beta
Synonyms: Topo III beta
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21976
Homologene: 2923
Gtf3c1
Name: general transcription factor III C 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233863
HGNC: HGNC:4664
Homologene: 31040
Clptm1
Name: cleft lip and palate associated transmembrane protein 1
Synonyms: HS9, N14
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56457
HGNC: HGNC:2087
Homologene: 37464
Srrt
Name: serrate RNA effector molecule homolog (Arabidopsis)
Synonyms: 2810019G02Rik, Ars2, Asr2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 83701
Homologene: 9298
Tubgcp5
Name: tubulin, gamma complex component 5
Synonyms: GCP5, B130010C12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233276
Homologene: 14172
Xpo6
Name: exportin 6
Synonyms: Ranbp20, C230091E20Rik, 2610005L19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74204
Homologene: 12544
Xpo7
Name: exportin 7
Synonyms: 4930506C02Rik, Ranbp16
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 65246
VEGA: 14
Homologene: 22857
Adam8
Name: a disintegrin and metallopeptidase domain 8
Synonyms: MS2, E430039A18Rik, CD156a, CD156
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11501
HGNC: HGNC:215
Homologene: 74384
Casp9
Name: caspase 9
Synonyms: ICE-LAP6, Caspase-9, Mch6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12371
HGNC: HGNC:1511
Homologene: 31024
Plxna4
Name: plexin A4
Synonyms: Plxa4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243743
HGNC: HGNC:9102
Homologene: 77587
Ppp3cb
Name: protein phosphatase 3, catalytic subunit, beta isoform
Synonyms: PP2BA beta, Calnb, Cnab, CnAbeta, 1110063J16Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19056
HGNC: HGNC:9315
Homologene: 56429
Ddrgk1
Name: DDRGK domain containing 1
Synonyms: 2600009E05Rik, 1110001I20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77006
Homologene: 11400
Baz2b
Name: bromodomain adjacent to zinc finger domain, 2B
Synonyms: D2Ertd794e, 5830435C13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 407823
HGNC: HGNC:963
Homologene: 8394
Dennd1a
Name: DENN domain containing 1A
Synonyms: 6030446I19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227801
Homologene: 17141
Mphosph9
Name: M-phase phosphoprotein 9
Synonyms: MPP-9, 4930548D04Rik, MPP9, B930097C17Rik, 9630025B04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269702
HGNC: HGNC:7215
Homologene: 11256
Wasf3
Name: WASP family, member 3
Synonyms: Wave3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 245880
Homologene: 68527
Col1a2
Name: collagen, type I, alpha 2
Synonyms: Cola2, Col1a-2, Cola-2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12843
HGNC: HGNC:2198
Homologene: 69
Hmcn2
Name: hemicentin 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 665700
Homologene: 90772
4931406C07Rik
Name: RIKEN cDNA 4931406C07 gene
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70984
VEGA: 9
Homologene: 8531
Abcb4
Name: ATP-binding cassette, sub-family B member 4
Synonyms: Mdr2, Pgy-2, Pgy2, mdr-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18670
HGNC: HGNC:45
Homologene: 136368
Sec14l2
Name: SEC14-like lipid binding 2
Synonyms: tap, 1300013M05Rik, Spf
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67815
Homologene: 8245
Zfp831
Name: zinc finger protein 831
Synonyms: OTTMUSG00000017459, ENSMUSG00000050600
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100043757
Homologene: 19013
Plekhh2
Name: pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213556
VEGA: 17
Homologene: 35317
Celsr2
Name: cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms: mfmi1, EGFL2, Adgrc2, flamingo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53883
HGNC: HGNC:3231
Homologene: 1078
Or4a80
Name: olfactory receptor family 4 subfamily A member 80
Synonyms: MOR231-18, GA_x6K02T2Q125-51193814-51192857, MOR231-19P, Olfr1253, Olfr1253-ps1, MOR231-19P, Olfr1559-ps1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258370
Abca8a
Name: ATP-binding cassette, sub-family A member 8a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217258
HGNC: HGNC:38
Homologene: 131160
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Cd19
Name: CD19 antigen
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12478
HGNC: HGNC:1633
Homologene: 1341
Hoxb3
Name: homeobox B3
Synonyms: Hox-2.7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15410
HGNC: HGNC:5114
Homologene: 1617
Obox6
Name: oocyte specific homeobox 6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 252830
Masp1
Name: MBL associated serine protease 1
Synonyms: Crarf
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17174
VEGA: 16
HGNC: HGNC:6901
Homologene: 88793
Vmn1r31
Name: vomeronasal 1 receptor 31
Synonyms: Gm6709
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 626828
Homologene: 115643
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Itprid1
Name: ITPR interacting domain containing 1
Synonyms: D530004J12Rik, Ccdc129
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232016
Homologene: 52344
Zfp687
Name: zinc finger protein 687
Synonyms: 4931408L03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 78266
Homologene: 10827
Fcgbp
Name: Fc fragment of IgG binding protein
Synonyms: A430096B05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 215384
Homologene: 68369
Morn5
Name: MORN repeat containing 5
Synonyms: 1700010A17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75495
Homologene: 16510
Tchh
Name: trichohyalin
Synonyms: AHF, Thh
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99681
Homologene: 136273
Ecd
Name: ecdysoneless cell cycle regulator
Synonyms: 5730461K03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70601
VEGA: 14
Homologene: 5256
Entpd1
Name: ectonucleoside triphosphate diphosphohydrolase 1
Synonyms: Cd39, NTPDase-1, ectoapyrase, 2610206B08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12495
HGNC: HGNC:3363
Homologene: 20423
Or6b13
Name: olfactory receptor family 6 subfamily B member 13
Synonyms: GA_x6K02T2PBJ9-42354580-42353624, MOR103-14P, Olfr524
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258055
Homologene: 79347
Trpc4
Name: transient receptor potential cation channel, subfamily C, member 4
Synonyms: Trrp4, CCE1, Trp4, STRPC4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22066
Homologene: 22955
Or4a75
Name: olfactory receptor family 4 subfamily A member 75
Synonyms: GA_x6K02T2Q125-51059648-51058725, Olfr1248, MOR231-10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258787
Homologene: 133613
Hesx1
Name: homeobox gene expressed in ES cells
Synonyms: HES-1, Rpx
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 15209
HGNC: HGNC:4877
Homologene: 20831
Uck1
Name: uridine-cytidine kinase 1
Synonyms: URK1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22245
Homologene: 7990
Zfp786
Name: zinc finger protein 786
Synonyms: A730012O14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330301
Homologene: 51849
Or2t43
Name: olfactory receptor family 2 subfamily T member 43
Synonyms: MOR275-10_p, GA_x6K02T2NKPP-858022-858862, MOR275-3, Olfr327-ps1, Olfr224, GA_x6K02T00261-652-347
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258198
Homologene: 133015
Pcdhgb2
Name: protocadherin gamma subfamily B, 2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93700
HGNC: HGNC:8709
Homologene: 49571
5730480H06Rik
Name: RIKEN cDNA 5730480H06 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70592
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 46,188,679 bp
  • C to A, chromosome 2 at 31,391,076 bp
  • C to A, chromosome 2 at 32,260,141 bp
  • A to G, chromosome 2 at 36,055,064 bp
  • T to C, chromosome 2 at 37,856,138 bp
  • G to T, chromosome 2 at 59,917,484 bp
  • C to T, chromosome 2 at 89,617,710 bp
  • A to T, chromosome 2 at 89,752,717 bp
  • G to A, chromosome 2 at 130,663,382 bp
  • A to T, chromosome 2 at 174,645,003 bp
  • A to G, chromosome 3 at 54,222,253 bp
  • CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC to CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC, chromosome 3 at 93,446,708 bp
  • A to T, chromosome 3 at 95,008,122 bp
  • G to A, chromosome 3 at 108,393,823 bp
  • C to A, chromosome 4 at 141,813,623 bp
  • G to A, chromosome 5 at 8,946,120 bp
  • A to T, chromosome 5 at 48,377,083 bp
  • A to T, chromosome 5 at 124,292,392 bp
  • A to T, chromosome 5 at 137,303,000 bp
  • A to T, chromosome 5 at 146,453,427 bp
  • G to A, chromosome 6 at 4,515,517 bp
  • G to T, chromosome 6 at 4,515,518 bp
  • C to A, chromosome 6 at 32,202,180 bp
  • T to C, chromosome 6 at 47,820,000 bp
  • C to T, chromosome 6 at 55,897,893 bp
  • T to A, chromosome 6 at 58,472,661 bp
  • C to T, chromosome 6 at 90,559,446 bp
  • G to C, chromosome 7 at 15,833,928 bp
  • G to T, chromosome 7 at 19,645,851 bp
  • C to T, chromosome 7 at 28,089,806 bp
  • T to A, chromosome 7 at 55,804,615 bp
  • T to C, chromosome 7 at 99,157,000 bp
  • G to T, chromosome 7 at 125,642,529 bp
  • T to C, chromosome 7 at 126,160,882 bp
  • C to A, chromosome 7 at 126,414,343 bp
  • C to T, chromosome 7 at 139,985,336 bp
  • C to A, chromosome 7 at 140,202,257 bp
  • C to T, chromosome 9 at 15,290,666 bp
  • G to A, chromosome 9 at 108,111,452 bp
  • C to A, chromosome 11 at 4,109,202 bp
  • A to T, chromosome 11 at 58,566,839 bp
  • A to G, chromosome 11 at 96,345,783 bp
  • A to G, chromosome 11 at 110,075,578 bp
  • G to A, chromosome 12 at 102,606,159 bp
  • A to G, chromosome 13 at 83,656,217 bp
  • T to A, chromosome 14 at 20,338,465 bp
  • C to T, chromosome 14 at 20,515,590 bp
  • C to T, chromosome 14 at 27,001,503 bp
  • C to A, chromosome 14 at 70,703,232 bp
  • G to T, chromosome 16 at 16,891,500 bp
  • T to C, chromosome 16 at 23,470,403 bp
  • A to G, chromosome 16 at 59,565,292 bp
  • G to A, chromosome 17 at 84,435,629 bp
  • A to G, chromosome 17 at 84,569,951 bp
  • A to G, chromosome 18 at 37,692,179 bp
  • A to G, chromosome 19 at 40,736,780 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8438 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067778-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.